Transcript asmbl_14884

Sequence
Transcript Sequence for observation asmbl_14884 of TGE0000334:
CTAGCTGCGCTTCCGCAAAGATGGCGGCGGCTGCGGGTAGCTGCGCGCGGGTGGCGGCCTGGGGCGGAAAACTGCGACGGGGGCTCGCTGTCAGCCGACAGGCTGTGCGGAGTCCCGGCCCCTTGGCAGCGGCAGTGGCCGGCGCGGCCCTGGCAGGAGCAGGAGCGGCCTGGCACCACAGCCGCGTCAGTGTTGCGGCGCGGGATGGCAGTTTTACAGTCTCCGCACAGAAAAATGTTGAACATGGAATAATATATATTGGGAAACCGTCTCTTCGTAAGCAGCGCTTCATGCAGTTTTCTTCACTCGAACATGAAGGAGAATATTATATGACACCACGAGACTTCCTCTTCTCAGTGATGTTTGAGCAAATGGAACGTAAAACTTCAGTCAAGAAGCTGACAAAAAAGGACATCGAGGATACACTGTCAGGGATCCAAACAGCTGGCTGTGGATCAACTTTTTTCAGAGACCTTGGCGATAAAGGGCTAATTTCATATACCGAGTATCTTTTCTTGCTTACAATCCTCACTAAACCCCATTCTGGATTTCATGTTGCTTTTAAAATGCTGGATACAGATGGTAATGAGATGATTGAAAAAAGGGAATTTTTTAAGCTGCAGAAGATCATAAGTAAACAAGATGACTTGATGACAGTGAAAACTAATGAAACTGGATATCAGGAAGCAATAGTGAAAGAACCTGAAATTAACACAACTCTTCAGATGCGTTTCTTTGGAAAAAGAGGACAAAGAAAACTTCATTATAAAGAATTTCGAAGATTTATGGAAAATTTACAAACAGAGATTCAAGAAATGGAATTCCTTCAGTTTTCTAAAGGTTTGAGTTTCATGAGAAAAGAAGACTTTGCAGAGTGGCTACTTTTTTTCACTAACACTGAAAATAAAGATATTTATTGGAAAAATGTGAGAGAGAAGTTGTCAGCAGGAGAGAGCATTAGTTTGGATGAATTCAAGTCATTTTGCCATTTTACAACCCACTTGGAAGACTTTGCTATTGCCATGCAGATGTTCAGTTTAGCTCATCGTCCTGTCAGACTAGCGGAGTTTAAGAGAGCTGTGAAAGTAGCAACAGGACAAGAACTCTCAAACAATATTTTGGACACTGTCTTTAAGATCTTTGATTTGGATGGTGATGAATGTCTTAGTCATGAAGAGTTTCTTGGGGTGTTAAAAAACAGAATGCATCGAGGTTTATGGGTACCACAACATCAGAGTATACAAGAATACTGGAAGTGTGTGAAGAAAGAAAGCATTAAAGGAGTAAAAGAAGTCTGGAAACAAGCTGGAAAAGGTCTTTTTTAATAAAAGATATAATAGTATGGCAATTATATTGTTCCAAATGTCAAAATTTGTGATTTTTTAGAAGTACTTGCTATTTATCTTCTTAAGTCTTCATTGATATTCT