Transcript asmbl_24337

Sequence
Transcript Sequence for observation asmbl_24337 of TGE0023895:
AGCGCATGCGCGAGTGTACGCGTTGCCGGCGAAGAGGGGAGCCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCGTGGAGACTGACATCTTGGAGTCGTTGGAAGATCTAGGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGATGGACCCCAGCAGCAAACAGGAGGCCGAGGAGGAGGGCGAGGTGGTTATGAACAGTCCTCATATGGAGGACGAGGAGGTCATGAACAAGGAGGAGGGAGAGGTGGACGTGGTGGCTACGACCATGGTGGCCGAGGGGGAGGAAGAGGAAATAAGCATCAAGGAGGCTGGACAGATGGAGGGAGTGGAGGAGGAGGTGGCTACCAAGATGGTGGTTATCGAGATTCGGGCTTCCAGCCTGGTGGCTATCATGGTGGCCACAGTGGTGGCTACCAAGGTGGTGGTTATGGTGGCTACCAAACATCTACATATACAGGAAGTGGATACCAGGGTAGTGGCTACCAGCAGGACAATAGATACCAAGATGGCGGGCACCATGGTGATCGAGGCAGTGGTCGCGGAGGGCG