Transcript asmbl_24336

Sequence
Transcript Sequence for observation asmbl_24336 of TGE0023894:
TTTATATTCTTCTGAAGTGTGATTTCTTAACTCACCAGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGATGGACCCCAGCAGCAAACAGGAGGCCGAGGAGGAGGGCGAGGTGGTTATGAACAGTCCTCATATGGAGGACGAGGAGGTCATGAACAAGGAGGAGGGAGAGGTGGACGTGGTGGCTACGACCATGGTGGCCGAGGGGGAGGAAGAGGAAATAAGCATCAAGGAGGCTGGACAGATGGAGGGAGTGGAGGAGGAGGTGGCTACCAAGATGGTGGTTATCGAGATTCGGGCTTCCAGCCTGGTGGCTATCATGGTGGCCACAGTGGTGGCTACCAAGGTGGTGGTTATGGTGGCTACCAAACATCTACATATACAGGAAGTGGATACCAGGGTAGTGGCTACCAGCAGGACAATAGATACCAAGATGGCGGGCACCATGGTGATCGAGGCAGTGGTCGCGGAGGGCGGG