Transcript asmbl_24207

Sequence
Transcript Sequence for observation asmbl_24207 of TGE0001355:
CGCCCCTCGGCTCGGTGGTAGGCTGAGACGGGAGGGTCCTCGGCTAAAGCCCAAAGCGGATCAAAGTGGTGGGACTCGCGCCGCGGCCGCGGAGACGTGAAGGCCCTCCGCACGCTCCTCCCGATCCCGGTCGGTGCTCGCCCTCGCTGTGCTCCCAGTCCCCATGGAGAAGACGGAGCTGATCCAGAAGGCGAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCGGTGGCCTACAAGAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATCGAGCAGAAAACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGCGGTCCATCTGCACCACCGTCCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGAGATTACTTCCGGTACCTTGCAGAAGTTGCATGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCTTTTGATATAAGCAAGAAAGAGATGCAGCCCACACACCCAATTCGTCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAACCCAGAGCTTGCCTGCACACTGGCTAAAACGGCTTTCGATGAGGCTATTGCAGAACTTGATACACTGAATGAAGACTCTTACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACATTGTGGACATCAGACAGTGCAGGAGAAGAATGCGATGCGGCAGAAGGGGCAGAAAACTAACTGCACGCAGGATGTCGTCCTTCTTCCCTCCAGAAACCTTTTTACACATCTCTGTTCCTTATTCCATTCGGATTTCCTATAGCGAAGAAACGCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTCCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCCGGTGTGCAGTTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATGAACATAAGTAACTTCCAAACACTTACATAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAGATATGAAAATGTAGTTAATTACAGTTTAAAGAGTGTTCTACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTTTTTTGGGGGTTTCCTTTCAGTAAAAACTTTTCCATGTTCTTAATGTATTCCTTTTTGGTAGGAATTCAGAAGTATTAGATTGAATGGAAAAGCATTTGACATTTCCGGGCTGGGGGTCACAAATTAAAATGCCTCCTGTATCACATACAATGGGGTTCCTGTGTATCTGTGACAACAGGGAGTTTCCTTATTCACTCTTCATTTGCTGCTGTTTCAGTTGACAACTTCCCTTCCCAATAAAAATTCACTTACGCCTCCCGCCTTTGTAGTTCTGGTATTCACTTTACTATGTAATAGAAGTAGCATGTTGCTGCCAGAATACAAGCCTTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAATTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACTCATATTTTAAGGGACAAGTGAATTTACTACTTTCTGAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTGATGCCCATATTTCTGCATTGTAATACACTTGTCTAGGGATGTCTGGAAATGTATAAAATTGGCCTACGTTTCTTAGAGTTAGTGTTTTATTCACAGATCGGTTTTGTGGGCCATCTCTTTCTCAGATGTAAATGATACCTAGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGAAAAGTTAATTATGTGATTGTGAATGCTTTGGGTGGTA