Transcript asmbl_23533

Sequence
Transcript Sequence for observation asmbl_23533 of TGE0004192:
GTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCTGTCTGGTCCGCGGCCCCAGAACCCGAGCTGAAGCGGTAGCGCAGGCTGCGGGAAGCTGAGTCGGAAGGCCTGAGTGTTTGTTCAAGCATGTCGGAAGGGGAGTCCCAGACAGTACTCAGCAGTGGCTCAGACACAAAGGTAGAATCCTCATCTTCAGCTCCTGGCCTGACATCAGTGTCACCTCCTGTGACCTCCACAACCTCAGCTGCTTCCCCAGAGGAAGAAGAAGAAAGTGAAGATGAGTCTGAGATCTTGGAAGAGTCACCCTGTGGGCGCTGGCAGAAGAGGCGAGAAGAGGTAAATCAGCGGAATGTACCAGGTATTGACAGTGCATACCTGGCCATGGATACAGAGGAGGGTGTAGAGGTTGTGTGGAATGAGGTACAATTCTCTGAGCGCAAGAACTACAAGCTGCAGGAGGAAAAGGTCCGTGCTGTATTCGATAATCTGATTCAATTGGAACATCTCAACATTGTTAAGTTTCACAAATATTGGGCTGACATTAAAGAGAACAAGGCCAGGGTCATTTTTATCACAGAATACATGTCATCTGGGAGTCTTAAGCAATTTTTGAAGAAGACCAAAAAAAACCACAAGACTATGAATGAAAAGGCTTGGAAGCGCTGGTGCACACAGATCCTCTCTGCCCTAAGCTACCTGCACTCCTGTGACCCCCCCATCATCCATGGGAACCTGACCTGTGACACCATCTTCATCCAGCACAACGGACTCATCAAGATTGGCTCTGTGGCTCCTGACACTATCAACAATCATGTGAAGACTTGTCGGGAAGAACAGAAGAATCTACACTTCTTTGCACCAGAGTATGGAGAAGTCACTAATGTGACAACGGCAGTGGACATCTATTCCTTTGGCATGTGTGCACTGGAGATGGCAGTGCTGGAGATTCAGGGCAATGGAGAGTCCTCATATGTGCCACAGGAAGCCATCAGCAGTGCCATCCAGCTTCTAGAAGACCCATTACAGAGGGAGTTCATTCAAAAGTGCCTGCAGTCTGAGCCTGCTCGCAGACCAACAGCCAGAGAACTTCTGTTCCACCCAGCACTGTTTGAAGTGCCCTCACTCAAACTTCTTGCTGCCCACTGCATTGTGGGACACCAACATATGATCCCAGAGAATGCGCTGGAGGAGATCACCAAAAACATGGATACCAGTGCTGTACTGGCTGAAATCCCTGCTGGACCAGGAAGAGAACCAGTTCAGACTTTGTACTCTCAGTCACCAGCTCTGGAATTAGATAAATTCCTTGAAGATGTCAGGAATGGGATCTACCCCCTGACAGCCTTTGGGCTGCCTCGGCCCCAACAGCCACAGCAGGAGGAGGTGACATCACCTGTGGTGCCGCCTTCTGTCAAGACTCCAACACCTGAACCAGCTGAGGTGGAGACCCGAAAGGTGGTGCTGATGCAATGCAACATTGAGTCAGTGGAGGAGGGAGTCAAACACCACCTAACACTTCTGCTGAAGCTGGAGGACAAACTGAACCGGCACCTGAGCTGTGACCTGATGCCAAATGAGAACATCCCTGAGTTGGCAGCTGAGCTGGTGCAGCTGGGCTTCATAAGTGAGGCTGACCAGAGCCGGCTGACTTCTCTGCTAGAAGAGACCCTGAACAAGTTCAATTTTGCCAGGAACAGCACCCTCAACTCAGCCGCTGTCACCGTCTCCTCTTAGAGCTCACTTGGGCCAGGCCTCTAATCTGAGCTGTGGCTGTCACTAGATATGCTGCAGCCTTCCTGCCCCTCCCCCCCAGTCAGTATTACCCTGTGAAGCCCCTTCTCTCCTTTATTATTCAGGAGGGCTTTGGGGCTCCCTGGTTCTGAGCATCACCCTACCCCTTCCCCTTTTATTCCTCCCCTCAGCACTTTGTTTACTTGTTTTGCACAGACGGGGGCCTGGGCCTTCTCAGCAGCCGCCTTCTAGTTGGGGGCTAGTAGCTGATCTGCCGGCTCCTGGCCTGCCTGTGTGGAAAGGGGGCCCACGGGCGCTGGGGGAGCCGAATTCTACAATCCCGCTGGGGCGGACGGGGCGGGAGAGAAGGGTGGTGCTGCAGTGGTGGCCCTAGGGGGCCATTCTGATTCGCCTCAGTTGCTGCTGTAATAAAAGTCTACTTTTTGCTAAAA