Transcript asmbl_23290

Sequence
Transcript Sequence for observation asmbl_23290 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTGGGGGCTTGGAGTGGGGTGGGTTGGGAGAATGTCAGTGAGTGGAAGTGTGGGTCTCTGTGCATGTGTGCGTGTGAGTGTGCTGCGTGAGGGGGAATGTATAATTTAAAGCTTGTCACGTGTCCTGGATAAGCAGAGCTCCTCAGCCTTTGTCCTCAGAACACCTCACATTCTTCCTGCTTCACCTCCTGAAGATGACCTAGGTAGCTGAGTGGGTGTTCTTCATTACCTCAGTGAGAAGCCAGCTTTCCTTCACGGGCCATTCTCCCTGAAGAGAAGGGCAGCGCTGAGGCCTCTTGTTCCAGAAAAAGAGACCCAGACTCTATCCTGAGTTTATGGTTCTTGAGCCTGACTCTCAGCAGCTATGGTAGAAACTGCTGGGTTTTGCAGCCTTGTTGTGTCATCTGTACCTCTATCTCCTTCCCTTTCCCTCAGGCTGAAGGAGAAATCAGGGGAGAGTTGAACCATCAGAGTCTGTGCCTTTTCCATCACCTTAGTCCAGCATGGTTCTCTCATAGGGGGAGTCCTTGCTACTTAATTCTTTGATCTGTTGCAAGAGATGATGGCAGGGCCACTCGGGGGCCACGCATGGCTTGGGAGAATGTGCTAGGGCCCCCCCGTTCATAATCATCACCCTTCAGATTTGCCCCATTGGCAGCTCCACCCTAGAGATTTGTTTAGATATGTTTCACCCTTAGACCAGCACCACTTCTTACCTCCTACTCCCACGCTCTCACTGCTGTTGACATTTACTACATGACTGAAAGCTTGGCCTCTGAGGGAGGGTGCTATGGTTAGAGCCAGGGGTCTGGCCCGCCCTTCAGGCCTTCTGCCCCTTGTCCAAGACACCACCGCACATCCAATCTTGTGCTTCTATGTGCTGTGTCCATCTATGGGGCCAACTGCATTTATCTACCTCTGGGATGTCTTGTGAAGGAGTCATTCCCACGGTCTCCGAGTCTGCTGGGCATAAGTGCCAGGGTAGAATGATGGGCCAGTTGTATCAGCCTGTGTGGCCTTTTCTCTTGTGGGCTGGGCAACCTCATTTTAACTCAGTCATTAATCTGAGAGGCCACAAGTACAGTTTTATTTTATTTTTCTCATTGGGGCACCTGAAACCATGATGAGGCTTACTTAAACCAAAGGATATGTATAGAAACACACTTGTATTATATTTGTAATTTTATCTGATGACAAAGAAGGAGAGGAGGAAAAATCCACACAGACTTAGGCTGGATACAGACAGCCCTACTTAGCATCATTCATAGCTCATGATTGCCCGGTCATGGGCTCTGTCATCCTGGATGTCTGTGGCGATGGGTGCATGGACATGCTGGACTTTTCCCTGAGGGGGAGGGAAAGTGGCTATTCTTTTTTTCTAACAATAGCAGTGACTCTATTGGTGTTTCCATTCATTCAACATTAACAAACACCCCCAACCTACAAGAAAAAAGGAAGGGCCTATAAACAGTGGTCTGATGATCAGAAAATCTAAGTCCTGGCCTCATTGTTATAGCTAAGGAATCTTTAACCTTAATTAAAGCAAGTCACTTTCTTTTCCCTGAGGCTCAGTTTTTCTAGTTTGAAAAATGATGGGTTTGGACCAGCCAATCTAGAAGGTCTCTTTCAGTGTCAGCATTCTAAGATGCTGGGACTTGCTGTGATATTGAACATGCAATGAAGATTTTGTGGGATGTTGATATTGTTTGTGTTTTTAGATGGCAGATCTGAAAGACCTGGCTTTGGCAAGAGCAGATGTCATTCCATATCACCTTTCTCAATGAAAAAAAACCTCATTCTATCCTGTCTTAGAGCCCCTTCTCCAACTTTTGTTAGCAGTTACATCTCCTGATGTAGCACTTAAGCTCCAATAAGTTCTTATATCTTAGTTCACTTTGCACTCATTTGCACACACATATTAGAGAGGAGAAATCCAAAAGAAGTAGCTGAAATGTGTATCCTGTATCCAGGTGCTAACCTTGAGAGTAAGCCTTGGAATTAGGAATGGGGCAAATGACCGAGCCCTGTCTCACCATGGATTACCCTTTACTGTAGGGGATGGTAATGTAGTGTGAGGATAAAAAGGGAATGGGGAGGGATGATAAGGAATCCAAGAAGTTTAGAACCTAACTATAACCTTTGGCTACTGAGACAAGAGTCCATTAGCATAGTAGTTGGACTTTAGATAGGATGGCTTATATGAAGAGACTATATCAAAGGAGGAAGAATGGGTATGTAAAAGATGAAGACATCAGTAGGAATCCTGTCTGAGCTTCTGGAACGGGGCTCATAGGCATTGAAGCCAGTGCTGTCTGTATGTGGGGAGAACCTATAGCTGAGTTCAGGACAGAACAAACAGCAGTCAGTTTTGGCATCATGTGGGGTGAACATCTAAATAGTATTTTGGCATCAGAAAATATAGCCCAAAGAGATTATTTGTGCCCTGGTCTGCGGCACAAATCTCAGGGTCTGCGGACAATAATGGGAAGCTTTGAACATTCCTGAGAAGTTGTCATACAAGGAGTCATGTTCTTTACTTTTCAGATATTCCTAGACCATCCAAGATTTCAAGAGACTTCTCTTTGTTAAGTATTCCTGGTTGAAATGACCTAAGTGCCTTTCTGACTTCCTAACCACCTCCTCTGTTTGAGTTGTGTAACAGTGAATTAAATGTGTTTTCCAAAAAGAATTGGCCTAAGGCTGCCTAGTGCTTCCTGTGTTATTTCTGTTTCTTTTGGGTGAAAAGAATAAGTGTTATTGCCT