Transcript asmbl_14864

Sequence
Transcript Sequence for observation asmbl_14864 of TGE0000333:
CTCCAGAGGACCACCCGGACGAGGAGATGGGGTTCACTATCGACATCAAGAGTTTCCTCAAGCCGGGCGAGAAGACGTACACGCAGCGCTGCCGCCTCTTCGTGGGAAATCTGCCCACCGACATCACGGAGGAGGACTTCAAGAGGCTCTTCGAACGCTATGGCGAGCCCAGCGAAGTCTTCATCAACCGGGACCGTGGCTTCGGCTTCATCCGCTTGGAATCCAGAACCCTGGCTGAAATTGCAAAAGCAGAGCTGGACGGCACCATTCTCAAGAGCAGACCTCTACGGATTCGCTTCGCTACACATGGAGCAGCCTTGACTGTCAAGAACCTTTCTCCAGTTGTTTCCAATGAGCTGCTAGAGCAAGCATTTTCTCAGTTTGGTCCAGTAGAGAAAGCTGTTGTGGTTGTGGATGATCGCGGTAGAGCTACAGGAAAAGGTTTTGTAGAGTTTGCAGCAAAACCTCCTGCACGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGTCTTGCCACTTGCCTAGTGAGGCTTTTCCGAACCTGGAAGGAGACGTCTAGAAATCCCAACTTTGCTGTGTAAGGACCATTAGCTGCAAGTCAGTGGAAGTCTATAGAAAGCAGTGTGAATTCCATAGTGGTCTTGACTTCTTAGCAAGGATTTGGGATAAGTCTAAAACTTCAGACTTAAAGCTTTGAAGCATGTTAACTGCATGAAATATTAAACATTTCG