Transcript asmbl_22440

Sequence
Transcript Sequence for observation asmbl_22440 of TGE0008462:
GCTCGCCTGACTGCTGCTGGCTCTGCGCTGAGGGACCCCCGCCACCATGGTCTCCGACGAAGATGAGTTGAATCTTCTAGTCATCATTGTTGATACCAACCCAATTTGGTGGGGAAAGCAAGCATTGAAAGAATCTCAGTTTACTTTATCCAAATGCATAGATGCAGTGATGGTGCTGGGAAATTCTCACTTATTCATGGATCATTCCAACAAACTTGCTGTGATAGCAAGTCATATTCAAGAAAGTCGATTCTTATATCCTGGGAAGAATGGCAGACTTGGGGACCTCTTCGGGGACCCCAGCAACCCTCCATCTGAATTTAATCCCTCGGGGAGTAAAGACGGAAAATATGAGTTGCTCACAGCAGCCAATGAAGTTATCGTTGAAGAGATTAAAGATCTAATGACCAATGGTGACATTAAGGGTCAACATACAGAAACTCTGCTGGCAGGGTCCCTCGCCAAAGCTCTTTGCTACATTCACAGGATGAACAAGGAGGTTAAAGATAATCAAGAAATGAAGTCAAGGATATTGGTGATCAAGGCCGCGGAGGACAGCGCGTTGCAGTATATGAACTTCATGAACGTCATCTTCGCAGCTCAGAAACAGAACATTCTGATCGATGCCTGCGTCTTAGGCTCTGATTCGGGACTCCTTCAGCAGGTACGTGTAAACGAGCGCGTGGCGGGGGCGTGAAGCGTGG