Transcript asmbl_22352

Sequence
Transcript Sequence for observation asmbl_22352 of TGE0004133:
AGGCGGGAACCACTGTCCCTGGTCAACGTGCGGAAGAGGAGCCTGGAATCTGGAGACGACGACCTGCCGACCAGGATGGACCACTACAAAGCCAAGGCTACGCGGCACATCTTCCTCATCAGGCACTCGCAGTACCACGTGGACGCGTCCCTGGAGAAGGACCGCACTCTGACGCCCCTGGGTCGTGAGCAGGCTGAGTTGACTGGTCTCCGACTTGCAAGCCTGGGGTTGAAGTTTAATAAAATCGTGCATTCCTCCATGACCCGTGCGGTGGAAACCACCGACATCATCAGTAAACACCTGCCAGGTGTCTCCACGGTCAGCACAGACCTGCTGAGGGAAGGTGCCCCCATCGAGCCCGACCCGCCCGTGTCGCACTGGAAGCCGGAGGCTGTGTATTACGAGGACGGGGCCCGGATTGAGGCTGCCTTCCGCAGTTACATCCACCGGGCAGACACCAAGCAGCAGGAGGACAGTTACGAGATCTTCATCTGCCATGCCAACGTCATCCGCTACATCGTGTGCCGGGCGCTGCAGTTCCCTCCGGAAGGCTGGCTCCGTCTCTCCCTCAACAATGGCAGCATCACCCACCTGGTGGTCCGGCCTGATGGCCGAGTGGCACTCAGGGCTCTTGGGGACACGGGCTTCATGCCTCCCGACAAGATTTCCCGCTCCTGAGGCCGCTGCGAGGCCAGTGCCTGGCTCTGCTGCGGGAGCCGGGAACAAGGGCCGTGTCCCCTGCCTTCCGTCCGCAGGTGGCACTGCGGTCGCTGTTTCTCCAGGATGAGGCTGCGGAGTGGAAACACCTGCCACACGGCACATCGTCATCCTCCTGCCCAGAGTGGCAGGGGGCGCTCGGGCCCCGCTGCCGGGTCTCCCCAGGTCCTCTGCCCCAGGCTCACCTACTAGGATGGGCCTGTGGGGGTGGAGGCCCCGCGGGGCCCTGCAGGTGTGCACCGGGGCCTGTGGCCAGGACCGCGACCGCAAGAGGCAGCGAGCCCATCAGGCTGAGGGCGTCAGGAGGGCCCGGCGCTTCCATCCTAATGTCTTTGCTTCGTACGTTCTTTTTGTAAGATCCTCTCGTCACTTATGTTAAAGACTTTCCTCACCTGGGTTCTTTTCTGAAAACCGATTCCTCGCTCCGGAGTTACGCACCCCTGATGCTACTGCATCTGAACTCACGTGTCTTCAAGGCCTTTGCGGACATGGGCACCCAGGCAGGTGGTGGGGGCCAGGGGGAGAGGGTCCTGTTTAAAATATCCAGCTGATGGCTGAATCTTTGTTTGCCTCTAGCTGTTAATCTTTTATGCTTATGGATGAAAACATTTAGACACGACATGTCCATCATAAGTATTCTGTTAATTTACCAAAAACCCTACAATTTCTGCGAAGTGGTTATGGACATTTTCTGCTGTGATCAGTGCAACTGAGATATTTGATCCATTTCTGTTAACTTGGAAATAACTACAAAATAAAGTTTTATTTTACTGGTTT