Transcript asmbl_22329

Sequence
Transcript Sequence for observation asmbl_22329 of TGE0004130:
GTTGACTGAAGCGAGCGAGCCGGGCTCCAGAGCGTCGAGGCGGAATCTCGGGCCCCCTGGAGTTGCAGCGGCTGCTCTGAGGCCAGCGCAGACATGGCTCACCTCAGGGGCTTCGCCAACCAGCACTCACGCGTGGACCCCGAGGAGCTCTTCACCAAACTGGACCGCATCGGCAAGGGCTCCTTCGGGGAGGTGTTCAAGGGCATCGACAACCGCACCAAGGAGGTGGTGGCCATCAAGATCATCGACCTGGAGGAGGCCGAGGACGAGATCGAGGACATCCAGCAGGAGATCACTGTGCTCAGCCAGTGCGACAGCCCCTACATCACCCGCTACTTCGGCTCCTACCTCAAGAGCACGAAGCTGTGGATCATCATGGAGTACCTGGGCGGCGGCTCCGCGCTGGACCTGCTGAAGCCGGGCCCCCTGGAGGAGACCTACATCGCCACCATCCTGCGGGAGATTCTCAAGGGCCTGGACTACCTGCACTCAGAGCGAAAGATCCACCGAGACATCAAAGGTCCCCGGGCTCGCCTCCTCTCCTGGCCCTCGAGCCCGCCAACCCTGGACAGGCCAGGGTGTGAGGTGGCAGGCGGCTGTGCGGGGCACGCGGCTGGTGGGGCTGGGGGCCTCGCAGCTCCGCGCTCCTGGCCTTTATCCCCTGCGGCCACCGGACACTGATGGCAGAGACGCTGGCGCCACGCCCTCATGCACCGGGAATGCCAGCCGTCTCCTGCTGGGAGAGCCACCGCACTGTGGGTTGGCCCTGCCGAGTCCCTGGGGAGGGGTCAGGGCCACCTGCATGCTGGCGTGGAAGGCAGGCCCGGGGAGGGCCCCTCACGCTTGCGGGCGCCCCCGGCAGTGCCCTGGCCTGGGCCTGTCTCTGGGCCGTGGGGGGAGGCAAAGCTGAGTGAGGCTCCACCAGCAGGTGCTGCTTCAGGCAGCTGCTCGCGGTGGGGTCTCCCTGGCTCAGAGCATGATGCCTCGCTGTCCTGTATCAAGCAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTGAGCTGC