Transcript asmbl_21960

Sequence
Transcript Sequence for observation asmbl_21960 of TGE0004108:
TGGGGATCTGGCTAGCGGGAAGGTGTGGCGGCGGGACCATCCGGGAAGATGCCCGTGGCCGTGATGGCAGACAGTGCCTTTAGTTTCAAAAAGCTGCTGGATCAGTGCGAGAACCAGGAGCTCGAGGCTCCTGGAGGAATTGCTACACCTCCAGTGTATGGTCAGCTTCTAGCTTTATATCTGCTCCATAATGACATGAATAATGCAAGATATCTTTGGAAAAGAATACCACCTGCTATAAAATCTGCAAATTCCGAACTTGGAGGGATTTGGTCAGTAGGACAGCGGATCTGGCAGAGAGATTTCCCTGGGATCTACACGACCATCGGCGCTCACCAGTGGTCTGAGACGGTCCAGCCAATCATGGACGCGCTTAGAGACGCAACGCGGAGACGCGCCTTCACCCTGGTCTCGCAGGCGTACACCTCCATCGTCGCCGAGGACTTCGCCGCCTTCGTTGGGCTCCCTGTGGAGGAGGCCGTGAAAGGCATATTAGAACAAGGATGGCAAGCCGACTCTACCACAAGAATGGTCACGCCCAAAAAGCCAGTCGCAGGCGCCCTGGATGTCCCCTTTCACGGGTTCGCTCCTTTATCAGAGCCAGCCCCGGTCCCGCCCATCCCCAACGAGCAGCAGCTCGCCAGACTCACCGACTACGTGGCTTTCCTCGAAAACTGACCGGTCCCGCCTCCCGGACCCACCCCGGAGCGCTGTGTCCTGAACTGATCCAGAAATGCTAAATTTTTATTTTCAGCTTATTGGATGGATTCAGCGCCTCAGCCTTCCTTCCTGAGTGTGCGATGGTAAAACACACATATACTGTAAAGCGCATCATGTGTATTTTGTCCTTAAGCGCCCCGCTGACTAGTTGAAGCAGGCCCGGTTTCATCACGCCACAGTGCGGGTGGGCCCGCCGGTGTCACGCAGCCCGTGTGTGTCCCAGCGGCTCGTGACTGAGCTCCCCTGCGTCCTGTAGCCAGGTGCCCGTCACCTGTGTTTCCCGGTCACGCACAGCACACCGTTCCTGCTGCTGGCCGTAGGGGCGCGCCCGGGGAGGAAGGCTGTGCCCGGCGGGACCTGCACTGTGGGGCGCTCCCATCCGCCCCCTCGGGAGAATGCGCACTCTGCTCCTCGCCCCGGAGTTGCCACTGCAGAGACGCAGCCGGGGACCCGAATGGTCTCAGGAGACCAGGCTGTTTTCCCTGGCTTCGCTGATGGTGTGAGCGCGCCCGTGGCCGCAGTGGAGGGCTTGCCGTGGAAGTGAGCCTCATTAAGACGTTCGCGAGA