Transcript asmbl_21867

Sequence
Transcript Sequence for observation asmbl_21867 of TGE0004100:
CGGGCCTAGGCGCGAGCCCGGAGCGCTGAATCCGCGCTTCGGCCCCGGAGCCGCGGTCTCCCGCCATGGGTCTCTGTCTCTTCCTCTACCGCGCACCCCTGCTTCTGTGGGGCCTACTGTTTCTCCTGCTGCTTGCAGTCTCGGCTCTCCAGGCTGGACGTCCGTCCCCTGTGGTCCTGGTGCCTGGTGATTTGGGCAACCAGCTGGAGGCAAAGCTGGACAAGCCAAAGGTCGTGCACTACCTCTGCTCCAAGAAAACAGACAGCTACTTCACACTCTGGCTGAACCTTGAACTGCTGCTGCCTGTCATCATTGACTGCTGGATCGACAATATCAGGCTGGTGTACAATAGAACGTCCCGGACCACCCAGTTTCCTGATGGTGTGGATATGCATGTCCCTGGCTTTGGGAAGACCTTTGCACTGGAGTTTCTGGACCCCAGCAAAAGCAGTGTGGGTTCCTATTTCCACACTATGGTGGAGAGCCTTGTGGGCTGGGGCTACACACGGGGTAAGGATGTCCGGGGGGCCCCCTATGACTGGCGCCGAGCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGGGAGATGATCGAGGAGATGCATCAGCTGTATGGGGGCCCCGTGGTGCTGGTTGCCCACAGTATGGGCAACATGTACACGCTCTACTTTCTGCAGCGGCAGCCACAGGCCTGGAAGGACAAGTACATCCGTGCCTTCTTGGCACTGGGTGCGCCTTGGGGGGGCGTGGCCAAGACCCTACGCGTTCTGGCCTCAGGAGACAACAATCGGATCCCGGTCATTAGTCCCCTGAAGATCCGGGAGCAGCAGCGATCTGCTGTCTCTACCAGCTGGCTCCTGCCCTATAACTATACCTGGTCACCTGAGAAGGTCTTCGTGCGCACACCCACGGCCAACTACACGCTGCGCGACTATCACCGGTTCTTCCAGGACATTGGCTTTGAAGATGGCTGGCTCATGCGGCAGGACACGGAAGGGCTGGTAGATGTCACAATGCCACCTGGCGTACAGCTGCACTGCCTCTATGGCACTGATGTCCCCACGCCGGACTCCTTCTACTATGAGAGCTTCCCGGACCGCGACCCTAAAATCTACTTTGGCGATGGTGATGGCACTGTGAACTTGCAGAGTGCCCTGCATTGCCAGACCTGGCGCAACCACCAGGCACACCAAGTATCATTGCAGGCGCTGCCAGGCAGTGAGCATATTGAAATGCTGGCCAATGCCACCACTCTGGCCTATCTGAAACGCATGCTCTTTGGGCCCTGATTCCTGTCCCAGCCAGGGCTGCGCGATGGCTCGGCTACAGCTGCTTCTCTTGGACTCTGGGGCTGCGATGGCCCATGAGTTTAGCAGTTTGTGACTGACCATCCAAGGTCCTGAGTCTTTGGTTGTGAAACATCTTCCATATGAAGTGCTGTTTCTTATCCTTTCTCTGGGAGGGAGGAAGGAAGAAATAGTCTAGACTCACTTGAGGGACCCTTAATGGAAAGAATGCTGCTGCTGATGGAATTGTGACCTCAGGACTGGCTCTGCAGGTGGATTGGCTGGCACCTGGATCCAATCCCCAACTCAGGGGCCATGTGTTCCTCCTATGCCTGTGGCCTTTTCACATTTACCCACCAGGCCTGGCCCCTCAGCCTTCCTGTAAGTGATATGACTAAGCTGTGGTTCCTACCCCCACAGGCCCCAGGAATGGGCTCCTGGTCCCTAGGGTGACCCTTCCCACACACTGGCCACAGGTGAGCCTACTACTGGCCATGGGTGGCTGGAGCTGCTGGCTTCCTTGTAGCATAGCTGCTTGACAGTCTGACTGGCTTTCTGAGGGCAGTCCAGTTTCCCCTGCAGGCAGGGGCAGATTGTTGTGTTCTCTGTGGTTCTCAGGCTCTGGGGCATTCACTCTTACCTCCCTCACCTCTAAAAACAGCCTAGCTCAGGATTGGGCAGCAGATGGCCCCTTAGTTCTGCAGCCATGGCCCAGGAGCTCTGATCCCCTTGGTCGGGCTGTTTCCCACAGTACTGATGTTAGCTTCCTTTACCTTGGGACTATGGTTCAAGGATAAGAGCAGGGCCCAGTGCCATGGCCTTTTAGGTCCTCATGAAGAAAGAAAACTTAAGGACACAGACAAGATGATTCGGAGTTTCTCTGAACTGCCCTCTTGCTAACTCTACCACCATACTGCCACCCTTCCCCACGGTTTCTCTAGTACCCAAGTGGGCTGGCACAGAGTCGAAAGGAGACAGGGCTTCTGCCCATCCTGCCCAGCACATACCTCCACCAGGCAGCTCAGTGGTGTTTAGTCTGCAGGGACAGCTCAGAACATACTTTGGGACCCTGTGAGACCCAGGTGCCTTGGAGCCCCCTTGGGGGTTTCTGTCTGCCTCAGAGGTGCTGCATGAGTCTCCTTGTGATAGCAGGGCTGGAGAATCTGGATTTACCTTGGTGGCAGTGGTCTCCAAGTAGGCGACAGCTATAAGCCAAGACTTGGGTCTAGCCTCTAGGGTGAGGCCCCAAAGCCACAGTCAGACTAGACTGTGCTGTTCTCCCACAAGATTTCTGTGGAGCCGGATTTTCTCTGTTGTGTACATACCCAGCATCTGTCTCTCCCTTTGTTTCTGAGTGGTGGGCCTCACCTGCATGGGGCTCTGAG