Transcript asmbl_21702

Sequence
Transcript Sequence for observation asmbl_21702 of TGE0004071:
GCTGACTACTACCCGGTGAGTGCCCTGGCTACAGGACAGTGGGTGAGCGTATTGGCACCTACATACCCACACCCAACAATGCCCTTATGCTCATGCTTCCCACCACTCCCCTGGGCCAGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCCAAA