Transcript asmbl_14863

Sequence
Transcript Sequence for observation asmbl_14863 of TGE0000332:
AGCCGGCGGCCGCGGCAGCCATGGCGCTCGCTCTTGCCGGGGAGCCGGCACCGCCCGCGCCCGCGCCTCCAGAGGACCACCCGGACGAGGAGATGGGGTTCACTATCGACATCAAGAGTTTCCTCAAGCCGGGCGAGAAGACGTACACGCAGCGCTGCCGCCTCTTCGTGGGAAATCTGCCCACCGACATCACGGAGGAGGACTTCAAGAGGCTCTTCGAACGCTATGGCGAGCCCAGCGAAGTCTTCATCAACCGGGACCGTGGCTTCGGCTTCATCCGCTTGGAATCCAGAACCCTGGCTGAAATTGCAAAAGCAGAGCTGGACGGCACCATTCTCAAGAGCAGACCTCTACGGATTCGCTTCGCTACACATGGAGCAGCCTTGACTGTCAAGAACCTTTCTCCAGTTGTTTCCAATGAGCTGCTAGAGCAAGCATTTTCTCAGTTTGGTCCAGTAGAGAAAGCTGTTGTGGTTGTGGATGATCGCGGTAGAGCTACAGGAAAAGGTTTTGTAGAGTTTGCAGCAAAACCTCCTGCACGAAAGGCTCTGGAAAGATGTGGTGATGGGGCATTCTTGCTAACAACGACCCCTCGTCCAGTCATTGTGGAACCCATGGAGCAGTTTGATGATGAAGATGGCTTGCCAGAGAAGCTGATGCAGAAAACTCAACAATATCATAAGGAAAGAGAACAACCACCACGTTTTGCTCAACCTGGGACATTTGAATTTGAGTATGCATCTCGATGGAAGGCTCTTGATGAAATGGAAAAGCAGCAGCGTGAGCAGGTTGATAGAAACATCAGAGAAGCCAAAGAGAAACTGGAGGCAGAAATGGAAGCAGCTAGGCATGAACACCAATTAATGCTAATGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATAGAGAACAGGAAATGAGAATGGGTGATATGGGTCCCCGTGGAGCAATAAACATGGGAGATGCGTTTAGCCCAGCCCCTGCTGGTAACCAAGGTCCTCCTCCAATGATGGGTATGAATATGAACAACAGAGCAACTATACCTGGCCCACCAATGGGTCCTGGTCCTGCCATGGGACCAGAAGGAGCCGCAAATATGGGAACTCCAATGATGCCAGATAATGGAGCAGTGCACAATGACAGATTTCCTCAAGGACCACCATCTCAGATGGGTTCACCTATGGGGAGTAGAACAGGTTCTGAAACCCCTCAAGCACCAATGAGTGGTGTAGGTCCTGTGAGTGGTGGTCCTGGTGGCTTTGGTAGAGGAAGTCAAGGGGGCAACTTTGAAGGCCCTAATAAGCGTCGTAGATATTAAACATTCGTTCATTCCTGGCTATCTAGAAAAAAAAAAGTCAGTGGTATGCCTTTATACTTTTACCTGTTATCTGGAAGAAATGGTTTTATTGTTA