Transcript asmbl_20697

Sequence
Transcript Sequence for observation asmbl_20697 of TGE0001383:
CGCGCCGCACCGTCAGTCTCCAGTGCCCAAATACACTCGAGCAACTCTCTTTCCCGGAATGCCACGCGGCGCGACCGCCCTCCGGGCAGTGTAAAGGCCCTTCGGTCTAAGGCTTTCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCTTATCTCATTCTTTTCCTTCGATTACCCGTGGCGCGGAGAATCAGGGCGGCGGCTGCAGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGAGACTCTGGAGTTGGAAAGTCTTGCCTCCTTCTTAGATTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGATGGGAAAACAATCAAGCTTCAAATTTGGGACACAGCGGGCCAAGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCGCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCTGATTCTCTTGGAATTCCATTTTTGGAAACCAGTGCTAAAAACGCAACGAATGTAGAACAATCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCAACAGCTGGTGGTGCAGAAAAGTCCAATGTTAAAATTCAGAGCACTCCGGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCGTCCTTTTCTCACAGCAGTGAATTTGCAATCTGAACCCAAGTGAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACCGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTCTATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAACCATTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACGTATGGTGATAAGTATTTTAATTCTATGGTTAAAGGGAAATAGAGCCTTTCATTATTCTTAAAACAGCCATTTCTGTGTGCAACCAGGGCATTGTAGACCTATCTTAGAGCAGCATTCAATATGTTTTCCAGATAATATATCCAATATATGACCTAGGGAGGCTTCTGTGCTGGGTAGGGATTTAACCAAGCTTAGTGGTTCAGGGAGATTAAACTGTATGAAAAGCAAGTTTAGGATGTATGCTTTCTAGCGCATTATCTTTGCTCCCTTCTCTGAAACCATTGGAAATGGTTTATTTGATCAACATTTTGTTAATTCTCTTCTGTGGTAGAGATAGAAAGCTGCACACCTTTCCTAATTGGCAAATGATCAGACTAACACATGTGCTAATTTTGTTTCTTCCATGCTGAGTCAGATGTTGACTATTTTATCCTCCACAATTATATAACAAGTTGGAGGAGAGTTAAAACATTAAAGTAGAAGGCAGGAAAAATTTACTATTTGATTGTCCTAATTTTAGAAATTATATCCTTAAAAATTAACTGAAAACACAAATGCTAGGTGGAAATGATGAGAGAAATATATTTATTTCAGTGGAATTTTGCACATGTGAAAATTTTGTTAAATAGGACCTTAAAAATCCTAGGGTTTGTTTTTATTGTGGGAAACAAAAATCTTTTGCTAACACTGGCATTTTAAGGTGATAGAAATCAAAGACTGTTTCCTTGGGATTGACGTAGCTACCAAAAACATTCTTAGAGGCTTGGGATGTGGCTGTTGGCAACACATTTTATGGTGGGGTCTTGAATTCAATGATAAAATTTAAATAAAACCAAGCCAAAAATTATAGGTTTCTTTATTTTCACTAAACAGGCAATTTAAATACATGGTACAAAAATAAGTCGTAAGATTATTGTAAAATGAAATGGACAGAATATTCAATTTAATTTTCCATCTATGAGAATTTCACAATAAAATCATAGTTTACTTTGTATTATAGATGTGCTTGTTGGATCTATTCATCCTCTCATAAGGCAACTGAAAAATTAAAGTTATCGAATAGTTATTTGGGTGAAGATTTTAAAAAATGCTTCAAAAGATCTGTTTTTTTGCCTTATAGTATAAAGGGGGAAAGACTTCAGAAACTATTTTCTAAAGTAGATAAATGATACAAATGTTAGATGTGATGCCACACACTTCAGTTTTATATAGCAAGTTGTTCACACTGTCAGCTTATTCTTGATGAGTTAGCATAAAACATGATGTGAATTTAAGATGTAAGTATATTTACATTACTTAGCTTTGAAAATGCTAGTGGTGTTCTCCCATTGCAGTAAAGACGGGCTTACCACAAGATGTTTCAGCATG