Transcript asmbl_20606

Sequence
Transcript Sequence for observation asmbl_20606 of TGE0023781:
CGCGCCCAGAGTGCGCAGTCCTTCGGCGAGCTTGTGTCGTCTGCCTGTTCTCTGAGCATCTTGTCACGGTCCTCTCGACGCGGACTCGCGCGTCCCACGCCTCGCGTCTTCCGGCCCGCCAGCGGGCTCCCGGCGCCCTCGTCGTTCCGTGCGCCCTCCCGCGAGCCCCGGCCCGCCTCGCGTCCGCCTCCTCAGCCCGCGCGCAGCATGGCGCCCCCCCAGGTCCTCGCGTTCGGGCTCCTGCTCGCGGCTGCGACGGCGGCAGTGGCCGCGGCTCAGAAAGAATGTATCTGTGAAAACTACAAACTGACCGCAAACTGCTCTGAGAACAGAGATGGTCAATGCCACTGTATTTCACTTGGTACACAACATTCTGTCATTTGCTCAAAATTGGCTACCAAATGTTTGGTGATGAAGGCAGAAATGTCTCACTCAAAGTTGGGGAGAAGACTAAAACCTGAAGATGCTATCCAAAATAATGACGGGCTCTACGATCCAGACTGTGATGAGAATGGGCTTTTTAAAGCCAAGCAGTGCAATGGCACCACCACGTGCTGGTGTGTGAACACTGCTGGTGTCAGAAGAACGGATAAAGACACTGAAAAATCCTGCTCTGAACGAGTGAGGACCTACTGGATTATCATTGAACTAAAACACAGAACAAGAGAAAAACCTTATGATATTCAAAGTTTACAGACTGCACTCAAGAAGATAATCACAACTCGTTATCAACTGGATCCAAAATATATCACAAATATTCTGTATGAGAATGATCTTATCACTATTGATCTGATGCAGAATTCTTCTCAGAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTTATTATTTTGAAAAAGATGTTAAAGATGAATCCTTGTTCCAGTCTAAGAAAATGGATCTAAGAGTAGATGGGGAACAGCTGGATCTGGATCCTAGTCGAACTGCAATTTACTATGTTGATGAAAAACCACCTGAATTTTCAATGCAGGGTCTAAAAGCTGGTATTATTGCTATCATTGTGGTTGTGACAATAGCAGTTATTGCTGGAATCGTTGTGCTGGTTATTTCCAGAAAGAACAGAACGGCGAAGTATGAGAAAGCTGAGATAAAGGAGATGGGCGAGATGCATAGGGAACTCAGTGGATAAATACTGTAATTTGAATAGTAACTACAAGAAGGGAAATTAGCAAATGGACTCAGATTACAAATATATGAGTGTGAGACAAAGAAATCTTTGAAGACTACTTTTGTTGACATATATTTGTAATGGTGATACCTATATTCAAAATATAAGTAGCTTGAAATTGACTTTACCAATCTTAAAATTTGACCACAAATGTCATATATATGAGATCTGATATCCCAGAATCTTTTAGTCTCAGAACTTTGACTGCATAGTTAAAATTATTTATACATAACACTGAAGAGTCCATTAAATATGCTTCCACAGTAGGTTTTGAATGACTACTATCTCATCCATTTGTGATTAAAACCTGCCTTCCTATTTACTTCGAGTCTTGTACATATACACCTTTTTTATGAACTATAAAATAAAACATTTTAAAAGTTTCCTAATTTTGTTTGAACTATATTGAATCAAATTTCCTAATTATATACATAATATGGTAAGAAATGCTTTGAATGCTAACTAAAAATTAATTTTGCATGAGTACTTCTAATCCTGTATATTCAATATAATATGTATAACATGTAACTGCTACACAGAAAAATATGTTTTATTCTGAACGAATCTGAGATTCTGTTTTAGACAGATTGGCATTTTGGCAGACCCTAACACCTTGAGGCAGATGTGGAGAATGTTGTGAACCAGGAATTCTATGGTTGGTTGGGTTAGAAGTACATTTCCAACATTTTATAAAATGAATAATTATAGTACGAATACATTTTATATGAAGTTAAAGAAATATTTTCCTTTTGATAGAAAATTTAAAAATGTGAAAAGAACATTAAAGAATATGTAAAAAGTAGATTTAAACGTGATTTTTATTCCTTCTATAGTAGGCAGAATTCTAGAATGGACCCCAAGATTTCATACCCCTGATGTATATGCCCTGTGTAGTCTCCTCCCCTAAAGTATGGGCAGGGCCTGTGAATACGATGGGCTGCCAAAATAAATTCCATTATGTGGCAGAGGTGAAGGGATTTTGCAGATGCAATTAAGAATCCTAATCAGTGGACAAAAGGGAGATTACTGTGAGTGGGCTTGACCTAATCAGGTGAGTCTTAAGAGTGTCTAAAATAAAGAGAAAAGAAGTGGAAACAGCAGAAGCGCTCTGTTAGCCTTAAAGCAAACCCCTGTTGTGGAAAGGGTCTCCTGTTAGAAGACAGCAGGCCTTCCAACTCTAGATGCTGAGGGCCTCGGTCCCAGAACCCCAGAAACTGAATTCTGCCAACAACCAGTGAGCTTGGAAGAGGACCCCAGTTCCAGATGACATCAAGCCATGGTGGACATCTTTACCAGTGTTGAGATCTTGAGTAAAAGACCCAGTTATGCTATGCTTGGACTCCTGACCCTTGGAAACTGAGATTAAATGTTTATTGTCTTAAGATGCAAAATTTGTGGCAATTTATGCAGTGATAGAAATTACTATAGCCAGTAGAAAGTAATGAGAACTTTAA