Transcript asmbl_19266

Sequence
Transcript Sequence for observation asmbl_19266 of TGE0003931:
GGGCCGCCCGGGTTCAGTCGCCACGTGAGTGCTCCTACCCTACCTGCGACACACTCCGCGGGCAGCATGTCGGCGACAGCGGTGGCTCGAAAGCGGGGAAAGCCGGCCTCGGGGGCCCGGGCTGGTGCGGGGGCCGGCAAGCGGCGGCGAAAGGCCGACTCTGCCGGGGACAGAGGCAAGTCCAAAGGTGGCGGCAAGATGAATGAGGAGATCTCCAGCGATTCCGAGAGTGAGAGCCTAGCTCCCAGGAACATGGAGGAGGAGGAGGAGCTGGAGGAGACCGCACAGGAGAAGAAGCTGCGCTTAGCCAAGCTCTACTTGGAGCAGCTGAGGCAGCAAGAGGAGGAGAAAGTGGACGCCCGTGAGTTTGAGGAGGACCAGGTGGCGGGGCGCCTGAAGGAGGACGTGCTGGAGCAGAGGGGCAGGCTGCAGAAGTCAGTAGCAAAGGAGATCCAGGCCCCAGCCCCAGCTGACATTCGCATCTTACGGGGCCACCAGCTCTCCATCACGTGTCTGGTTATCACCCCTGACGACTTGGCCATCTTTTCTGCCGCCAAAGATTGCACCATCATTAAGTGGAGTGTGGAGAGTGGACGGAAGCTTCACGTGATCCCACGAGCCAAGAAAGGGACCGAGGGGCAGCCCCCCGGCCACAGCAGCCACGTCCTCTGCATGGCCATCTCCTCCGACGGCAAGTACCTTGCCTCGGGCGACCGCAGCAAGCTCATCCTGATTTGGGAGGCCCAGAGCTGCCAGCACCTGTACACCTTCACGGGGCACCGGGACGCCGTGTCGGGGCTGGCATTCCGCAGAGGCACCCACCAGCTCTATAGCACGTCCCACGACCGTTCCGTGAAGGTGTGGAACGTGGCAGAGAACGCCTACGTGGAGACCCTCTTCGGGCACCAGGACGCCGTGGCTGCATTGGATGCCCTGAGCCGGGAGTGCTGCGTGACGGCTGGGGGCCGGGATGGGACCGTGCGTGTGTGGAAGATCCCCGAGGAGTCGCAGCTTGTCTTCTACGGCCACCAGGGCTCCATCGACAGCATCCAGCTCATCAACGAGGAGCACATGGTGTCAGGCGCAGACGATGGCTCTGTGGCTTTGTGGGGCCTCTCCAAAAAACGGCCACTTGCTCTGCAGCGTGAAGCCCACGGGCTGCGGGGGGAGCCGGGCCTGGAGCAGCCCTTCTGGGTGTCGTCGGTGGCAGCCCTGCTCAACACAGACCTCGTGGCCACAGGCTCCCACAGCTCTTGTCTGCGGCTCTGGCAGTGCGGGGAGGGCTTCCGGCGGCTTGACCTTCTCTGCGACATCCCCCTGGTGGGCTTTATCAATAGCCTCAAGTTCTCCAGCGCTGGGGACTTCCTCGTGGCTGGGGTGGGGCAGGAGCACAGGCTGGGCCGCTGGTGGCGAATCAGAGAGGCTCGGAACTCTGTCTGCATCATCCCGCTTCGGAGGGGTCCCAGGCCCACGGCCGCGGGCTCTTAACCTTCTCATCCCCTTTATTTAAGTCCTTCCCAAGCCGCGTCCTTCCCTTTTTGTATTAAAAGCCTCTCTTTTGG