Transcript asmbl_19193

Sequence
Transcript Sequence for observation asmbl_19193 of TGE0001731:
AGTGCCTTTCATCTGAGAAGTTCAAGGCACTTCGTAGAACTTCTGCCACACAGGCCGTGGGTCTTGCAGCACATTTGTAAGCAATGGCTGCCATCAGGAAGAAATTGGTGATTGTTGGTGATGGAGCCTGTGGCAAGACCTGCTTGCTTATCGTTTTTAGCAAGGACCAGTTTCCAGAGGTGTATGTACCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCTTGAGGCCCCTCTCCTACCCGGACACTGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCCGGAAGTCAAGCATTTCTGTCCCAATGTGCCCATCATCCTGGTTGGAAACAAGAAGGACCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTAAAACCAGAAGAAGGCAGAGATATGGCGAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAAACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACGAGAGCTGCTCTGCAAGCCAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCCTGCTGCAAGCACAGCCCTCATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCCTGCTACCAGTATTTAGAAGCCAAGCCAACCATGATTATTAATGATGTCCAGCCCACCTGACCCGCCGGGGGCCTTCTGACACCGCTCTAACAGCCCTCCTCTGCACTCCACCTGACACACCAGGCACTAATTCAAGGGATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAATGGTAACTTTTGTGAATTAGGCTGTAACTACTTCATAACTAACATGTCTTGCCTCTCATCTGTCAGCTGCAACGTATTCTGGTGAGTCACCACTTCAGAGCTTTACTCCTTAACAGATTGCATTGGCATAGCTCTGGAGTGGCCATCCAGTTTTTTCAAAATGGGCTCAGCCAGAAAGGCCCAAGTCCATGCAGCTGTGGCAAAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGATATTTGTCATCCCCACAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGAAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCAGTTTCTCTGATAAAAGATGACCATCTCACCTGTTTTCAGCCCCACATGTCCCAGTCCCCCTCCCCAGAGCTGGGCTAAGTAAGTAGGAATTTGGTTTCAAGCGCCCGAGGCACTCAGACACTTCTGAAGGTGGCACAACCTGTCTGGACCGCAGGGTCGGCCTCTAGTTCACAGTGCTTTCTCCTCACTGTATCTAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCGTGGGTGGCACTGTGTTTCTCTCCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA