Transcript asmbl_18760

Sequence
Transcript Sequence for observation asmbl_18760 of TGE0001880:
CGGAAGTGGGAGCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCATTGCCTTTGCCCTGTCTTTTTTTGTTCTTCCAGACCTTTGGCTCAGTAGACACCATGTTAGCTAATCATAACCAATGCTTTATCAAGCAAAATAGCCCTCCA