Transcript asmbl_18757

Sequence
Transcript Sequence for observation asmbl_18757 of TGE0001766:
CGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAAGCTGATAGTTTGGACTTTTCTTTTTGTTACCTCAGTCGTGTCTTCGATAATGAAATATAGCTATTACAAGGAAGCATAGGCTTTATAGTTTGGTGTCAAT