Transcript asmbl_18739

Sequence
Transcript Sequence for observation asmbl_18739 of TGE0018079:
CGCCTTAGTAACAGCCGCATGGTAACTCAAGTTCCCTGCGTGCGGTACTCGCTCCTACTTTTCCACGCAGGTCTTGGCTCCCGACTTCTGCAAGATGAAGATTGAGGAGGTGAAGAGCACCACGAAGACACAGCGCATCGCCTCCCATAGCCATGTGAAGGGGCTAGGGCTGGACGAGAGCGGTCTGGCCAAGCAGGCAGCCTCGGGGCTCGTGGGCCAGGAGAACGCACGAGAGGCATGTGGTGTGATAGTAGAATTAATCAAAAGCAAGAAAATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTAGCTCTGGCTATTGCTCAGGAGCTAGGTAGTAAGGTGCCTTTTTGCCCCATGGTGGGGAGTGAAGTTTATTCTACAGAGATAAAGAAGACAGAAGTGCTGATGGAGAACTTCCGCAGGGCCATCGGGCTGCGGATAAAGGAAACCAAGGAGGTTTATGAAGGCGAAGTCACAGAGCTAACTCCGTGTGAGACAGAGAATCCCATGGGGGGGTATGGCAAAACCATTAGCCATGTAATTATAGGACTCAAAACAGCCAAAGGAACCAAACAATTGAAACTGGACCCCAGCATTTTTGAAAGTTTGCAAAAAGAACGAGTGGAGGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGAGCCGTGAAGAGGCAGGGCAGATGTGATACTTATGCCACAGAATTTGACCTTGAAGCTGAAGAGTATGTCCCCTTGCCAAAGGGAGATGTGCACAAGAAGAAAGAAATCATCCAGGATGTGACCTTGCATGACCTGGATGTGGCCAATGCCCGGCCCCAGGTACTGCTTTGACGCCAGCACTACCTGGCACACAAACCCTTTGC