Transcript asmbl_18737

Sequence
Transcript Sequence for observation asmbl_18737 of TGE0023713:
CGCCTTAGTAACAGCCGCATGGTAACTCAAGTTCCCTGCGTGCGGTACTCGCTCCTACTTTTCCACGCAGGTCTTGGCTCCCGACTTCTGCAAGATGAAGATTGAGGAGGTGAAGAGCACCACGAAGACACAGCGCATCGCCTCCCATAGCCATGTGAAGGGGCTAGGGCTGGACGAGAGCGGTCTGGCCAAGCAGGCAGCCTCGGGGCTCGTGGGCCAGGAGAACGCACGAGAGGCATGTGGTGTGATAGTAGAATTAATCAAAAGCAAGAAAATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTAGCTCTGGCTATTGCTCAGGAGCTAGGTAGTAAGGTGCCTTTTTGCCCCATGGTGGGGAGTGAAGTTTATTCTACAGAGATAAAGAAGACAGAAGTGCTGATGGAGAACTTCCGCAGGGCCATCGGGCTGCGGATAAAGGAAACCAAGGAGGTTTATGAAGGCGAAGTCACAGAGCTAACTCCGTGTGAGACAGAGAATCCCATGGGGGGGTATGGCAAAACCATTAGCCATGTAATTATAGGACTCAAAACAGCCAAAGGAACCAAACAATTGAAACTGGACCCCAGCATTTTTGAAAGTTTGCAAAAAGAACGAGTGGAGGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGAGCCGTGAAGAGGCAGGGCAGATGTGATACTTATGCCACAGAATTTGACCTTGAAGCTGAAGAGTATGTCCCCTTGCCAAAGGGAGATGTGCACAAGAAGAAAGAAATCATCCAGGATGTGACCTTGCATGACCTGGATGTGGCCAATGCCCGGCCCCAGGGGGGACAAGACATCCTGTCTATGATGGGTCAGTTAATGAAGCCGAAGAAGACAGAAATCACAGATAAACTTCGAGGAGAGATTAACAAGGTGGTGAACAAGTACATTGATCAGGGCATTGCTGAGCTGGTTCCAGGTGTGCTCTTTGTTGATGAGGTCCACATGCTGGACATCGAGTGCTTCACTTACCTGCACCGGGCCCTGGAATCTTCTATTGCCCCCATTGTCATCTTTGCGTCCAACCGAGGCAACTGTGTCATCAGGGGCACTGAGGACATCACCTCCCCTCATGGCATCCCTCTTGACCTTCTAGACCGAGTGATGATCATTCGGACCATGCTGTACACTCCACAGGAAATGAAACAGATCATTAAAATCCGAGCCCAGACAGAGGGAATCAACATCAGTGAGGAAGCGCTGAACCACTTGGGGGAGATCGGTACCAAGACCACTTTAAGAGGAGCCTGAGACCTCAATCCA