Transcript asmbl_18581

Sequence
Transcript Sequence for observation asmbl_18581 of TGE0003908:
CCTACCCCCGCCCGCGGGTTTCCGCGCGCCTCTTTGGCAGCTGGTCACATGGTGAGGGTGGGGGGTAAGGGGGCCGCTCTAGCCTGCGGCCTGTGTCTATGGTCTGGCCCATAGGGTCCAGCTGCCCCCGACAGAGTTCAAGTGTATGGCGCCGCAGGAACCGTCTCCGGGGCCCCGATAACGGGCCGCCCCCGCAGCTCCCGGCACGGGGTGAAGGTCTCCTTTGATCTGAGAATGGCTACCCCTCGATATGAGCCAGTGGCTGAGATTGGTGTTGGTGCGTATGGAACGGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTCGCCCTCAAGAGCGTGAGAGTTCCCAATGGAGGTGCTGGAGGGGGCCTTCCCATCAGCACAGTTCGTGAGGTTGCTTTACTGAGGCGGCTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGATGTCTGTGCCACAGCCCGAACTGACCGGGAAACCAAAGTGACCCTGGTGTTTGAGCATGTGGACCAAGACCTAAGGACGTATCTGGATAAGGCACCCCCACCAGGCTTGCCAGTGGAGACCATCAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAACTGCATTGTTCACCGGGACCTAAAGCCAGAGAACATTCTGGTGACAAGTGGTGGGACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCTGTGGTTGTTACACTCTGGTACCGTGCTCCAGAAGTTCTTCTGCAGTCTACGTATGCAACACCTGTGGACTTGTGGAGTGTTGGCTGTATCTTCGCTGAGATGTTTCGTCGAAAGTATGGGACTCAAGTATCCTGAACTATATTGAATATCCCAAATCTCTTATTCATAAACCACATCCCTACCCTGCCCATTCTTTCACTTGAGTATTACTGACCACCTTGTCCATAACCAGAAGCTCTGAAATGTCCTGGAGTTAGGAACTTATCTCTTTAGTCGCTATACCCTTTGTTTTTTAGCCACTAATCAATAATCATTCTACTACCATATCTTTGAAAATACCTTAGGCC