Transcript asmbl_18571

Sequence
Transcript Sequence for observation asmbl_18571 of TGE0014907:
GCTTTACCCTTCTCTTGTGTTACTGCTGTCGCGAGACTTCCTACTCCTCCGCCTCCTCCGCCGCTCCCTTTGCTGCCGCTTTAGCCTGGGACCCGGACCCAGCCTCTCCCCCACTCGAACGTCGGCCCCGGCTCTGCCGAGGTCCCGGTCCCCCAACCCCGCCTCGCCGCCGCCATGGCGGACCCTAAATACGCTGACCTTCCCGGCATTGCCAGGAACGAGCCAGATGTTTATGAAACCAGCGACCTACCTGAGGATGACCAAGCGGAGTTTGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCCAATGCTGCCTATGACAAGTTCAAAGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGAATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGGTTTGTTGTGTGTGTGTTGATGGGAATGGTGCAGTGATCCTATCTAGTAGGAGATCAAGGGATACAGGTGGATTCCAAGTTTCTCTCTGATGGGAGGTCCTGAGGAACCTTGCAGGATACAGTTGAGAATGCTTTGTCCTTCTGCTGTTTGCTCTGGAGAAGCTCCAGCTATTTCAGTTCTTCTGTAGTAGAGTTTTGTGGATTCTGAATTGGATATAATACCCTTACCACTGAGGCCCAGCGTTTGGATAAATTATTGGGGTTCCCTGTGCTGGGAGGTGTCACATCACCATCTACGCTTGCTCTCTAGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTG