Transcript asmbl_18568

Sequence
Transcript Sequence for observation asmbl_18568 of TGE0014907:
GCTTTACCCTTCTCTTGTGTTACTGCTGTCGCGAGACTTCCTACTCCTCCGCCTCCTCCGCCGCTCCCTTTGCTGCCGCTTTAGCCTGGGACCCGGACCCAGCCTCTCCCCCACTCGAACGTCGGCCCCGGCTCTGCCGAGGTCCCGGTCCCCCAACCCCGCCTCGCCGCCGCCATGGCGGACCCTAAATACGCTGACCTTCCCGGCATTGCCAGGAACGAGCCAGATGTTTATGAAACCAGCGACCTACCTGAGGATGACCAAGCGGAGTTTGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCCAATGCTGCCTATGACAAGTTCAAAGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGAATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGGTCAGGTGCTCTCCTGTACTTAGTCTGACCCTCACATCCTGCACCATAAGCCTGAGGTCCACAGCATTCCACAGAATTCTGGGAACAGTCGGGAAAGGGCTTCAGTTACAGGATCAACCAGTGGGCTGCCAACTAGAACATAAAGAATAGGAGAACGTGGTGATCACATAGAGGTATTAGAACCACTGATTTCTTTCCTCCTTTTCCCCACCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTG