Transcript asmbl_18466

Sequence
Transcript Sequence for observation asmbl_18466 of TGE0003894:
GGGGCCGGAGCCGGGGGGCGCAGCTAGAGAGCCCCTGAGCGGCGGCGAGAGAGGATCGCACGGCCTCGAGGAGCCCAGGTCCGGCAGCCATGGCGGTGGAAGGAGGAATGAGATGTGTCAAGATCTTGCTCTACGTTTTTCTGGTGGCTTTTTGCGCCTGTGCAGTGGGACTGATCGTTGTGGGTATAGGGGCCCAGCTCGTCCTGAGTCAGACCATCAGCCAGGGGGCCACTCCTGGCTCCGTCTTGCCTGTGGTCATCATCGCAGTGGGTGCCTTCCTTTTCCTGGTGGCTATTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTTATGATCACGTTTGTTATCTTCCTGTCTCTTATTGTGCTGGTGGAGGTGGCTGCAGCCATTGCTGGCTATGTGTTTAGAGACAAGGTGATGTCAGAATTTAATAAGGACTTCCGGCAGCAGATGAAGAATTATCCAAAACAGAACCAGACGGCTTTGATCCTGGACAGGATGCAGGAAAATTTCAAGTGCTGCGGGGCAGCTAACTACACAGACTGGGAGACCATGCTTCTTGAGCCCAAAGGCCGAGTCCCTGACTCCTGCTGTATCAATGTCACTCAGGGCTGTGGGATTAATTACAATGTGAAGGAGATCTATACCGAGGGCTGTGTGGAGAAGATTGGGTTCTGGCTGAGGAGCAATGTGCTGGTGGTGGCTGCAGCAGCCCTGGGCATTGCCTTTGTGGAGGTCCTGGGAATTGTCTTTGCCTGCTGCCTTGTGAAGAGTATCCAAAGTGGCTATGAAGTGATGTAGGAGGTCTGGTCTCTTCAGCCCCTCTTCTAGGAGGGTGGGGTAATATACTCCATGTTTTTCAATTAAACGGATTATTTTTTCAGACCG