Transcript asmbl_18351

Sequence
Transcript Sequence for observation asmbl_18351 of TGE0003870:
GTGGTAGGGAACTTGGTGGGGGGGAGGCGGCAACATTGTTTCAAGTTGGACAAATTGACAAGAGCGAGAGATACACTGAGTTCCATCCGGACCTGGAGACGCGGTTCTGGGCCCTGTTTTCCCCTCCTCCGCCCCCGAGAGCCGGGGCCCGCTTTTTGCAGGGTTCCCAGGCCCCCGCTCCAGGGCCGGGCTGACCCGACTCACTAGCGCTTCATGGAGAACTTTCAAAAAGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAAAAACAAGCTGACTGGAGAAGTGGTGGCGCTTAAAAAAATCCGCCTGGACACTGAGACAGAGGGTGTACCCAGTACTGCCATACGAGAGATCTCTCTACTTAAGGAACTTAACCACCCTAATATTGTCAAGTTGCTGGATGTCATCCACACAGAAAACAAACTCTACTTGGTTTTTGAGTTTCTGCACCAGGATCTCAAGAAATTTATGGATGCCTCTGCTCTTACTGGTATCCCTCTTCCCCTCATCAAGGTAATCTTTCTCATCAACTCTTCCCCAACATGGGCATGTCTTGGGGGAACCGAAGGCAGGCAATTCAGACTGAATGATGATTTGTGACCTTGGTTTCCTTCTCAGCTCTCTTCTTCCTATATATACACACACCTTTCTTTTGTGAGTCTTTCACTG