Transcript asmbl_17496

Sequence
Transcript Sequence for observation asmbl_17496 of TGE0003840:
GGGGCCCTGGCTCAGCCAATGTCTCGTTGTGGGTGGGGTTATGCGGGGCGGACTGGGCAATAGGACTTCCGGAAATCTGTGCCGGAGCACCCCTGCTTCCTAATCAAAGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTCAAACATT