Transcript asmbl_17458

Sequence
Transcript Sequence for observation asmbl_17458 of TGE0003834:
CCCGTGGCTGTGAAGGAGGCCTGAGAGCGACATGTCCCCGGCGGCTGAGGCAGAGCGGCCCGTGGCGCTGTTTGTCTGAGTCCAGGGCGGCCTGGCGGCCGGCTGAGGAAGAGGGTCGGCGGAGGCTGCCCCCGCTGTAGTGGCCGCCATGCTGGGGGCCCGGGCAGCTGAGGGAGTCGCCGTGGCGCTTCTGAGGCTGCTGCTGCTGCTGCTGCTGTCGGCGCTCCGGGGGCCGGGGCTCGGCGTGGTCGGCACGGCGGGGGCTGGGCTGTCGGACAGCGTTATTTGGGCGGTCAACGCGGGCGGCGAGGCGCATGTGGACGTGCACGGGATTCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCTGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTATATCAAACAGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGATGAGGGAGACTATGTGTTGGTGTTGAAATTTGCCGAGGTCTACTTTGCACAGTCCCAGCAGAAGGTATTTGATGTGCGATTGAATGGCCACGTGGTGGTGAAGGACTTGGATATCTTTGATCGAGTTGGGCACAGCACAGCTCATGATGAAATCATCCCTATGAGCATCAGAAAGGGGAAGCTGAGCGTCCTAGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTCGTCAAGGGTTACTATGACAATCCCAAAGTATGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTGCAGCCTCATCCAGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATACGATGAAGGGTCTAATCTCAAAAGACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTCCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGAGGACAAATTACCATCCTGAACAGGGTGGAGGGTGTGGGAAAGAAACCAAACGTGTTGGTTTGGTTTCTGTATTTTTCATGGTGATTAACACACACACACACACACACACA