Transcript asmbl_17271

Sequence
Transcript Sequence for observation asmbl_17271 of TGE0023649:
CACCCAAGCCCTTCATTTCTCTCGGTTGGGTTTGCGGTGGGGCACGAAGAGGATGGCGGGTGAAAAAGCTGAGAAGCCAGACACTAAAGAGAAGAAGCCTGAAGCCAAGAAGGCTGATGCTGGTGGCAAGGTTAAGAAGGGTACCCCCAAGGCCAAAACGCCTAAGAAGGGAAAACCCCACTGCAGCCGGAACCCTGTCCTGGTCAGAGGAATTGGCAGGTATTCCCGATCAGCCATGTATTCCAGAAAGGCCATGTACAAGAGGAAGTATTCAGCAGCTAAATCCAGGGTCGAAAAGAAAAAGAAGGAGAAGGTTCTCGCTACTGTCACAAAACCAGTTGGTGGTGACAAGAACGGTGGCACCCGGGTGGTTAAACTTCGCAAAATGCCTAGATATTATCCTACTGAAGATGTGCCTCGAAAGCTGTTGAGCCATGGCAAGAAACCCTTCAGTCAGCATTCAAGAAAACTTCGGGCTAGCATCACCCCGGGGACCATTCTGATCATCCTCACTGGGCGTCACAGAGGCAAGAGGGTGGTTTTCCTGAAGCAGCTGAGCAGTGGCTTGCTACTTGTGACCGGACCTCTGTCCCTCAATCGAGTCCCTCTGCGTAGAACACACCAGAAATTTGTCATTGCCACCTCCACTAAAATTGACATCAGTGGTGTGAAAATCCCCAAACATCTCACTGACGCTTACTTCAAGAAGAAGAAGCTGCGCAAGCCCAGACACCAGGAGGGTGAGATCTTCGACACAGAGAAAGAGAAATACGAGATTACAGAGCAGCGCAAGATTGATCAGAAAGCTGTGGACTCGCAGATTCTGCCAAAAATCAAAGCTGTCCCTCAGCTCCAGGGCTACCTCCGCTCTGTGTTTGCTCTCACAAATGGTGTTTATCCTCACAAACTGGTTTTCTGAGTTGATGATGAAGAACCTCATTAAACGCCTGTTATGTTTCCTTTGTGTCTTTTTTTTTATTCTTTTCCTTTTAATTCTGCCTGGCCATGTGGTTTGACTTGGCCAGTTTGACGGGGTGTCAGCCTCTGCTAAAGCCGGGTTGTAACAGCTGCTGCAGATGCTCCCCAGCCTTGGGTCAGCATTCTTAGCTTCCTTAGTGTCTGGCTTCTCTGCTTTTTTGCCTCGCACCAACCAATGTAAAATAGCATTTTCCCAGTCATCGCAGAGCAAGTTAGTACTGAACCATTTGTGGAAAAGAAACGTGGGCTCTTCAAGCCACAGACGTCCTCCCTTGCAATGATTTAACATTCATTTCTCCCCCATCTGTGTAATTCTCAGCCCCTTCCCCATAATTATTGGTGTGTTTTGAACACAAAGCAAATAAGTATATTTACCCTCCCTTTTTAACCAAAAACCTAGGATACTGTACATACTATTGGATAACCGTGTATTTTGATCATTCCTTAAAAAATGTTCATCTTTACTGCTGCATAGTGCAGTGGTTCCCCCTTATCCATGGAACGTGATCCAAGACCCTTCGGATGCCTGAAACCGTGGATAGTACTGAATCCTGTATTTACTGTTTTTTTCCTATATATGCATACCTGATAAAGTTTGACTCATAAATAAGGCACAGTAAGAAATCAACTACTGAGACAATTGCACTAATAAAAGTTTTGTGAATGTGGCCTCAAAATACCTTGTTCACTCTTACGACGTAAGTGCCTACGTGCTAAGATGAAGTGGCGTCGTGACAGTGTTAGGATATTGAGCTGACAATAAGGTCAGGAGGGCCGTTTGCTTTGGGTGATCCTGGATCACTGAGCCATAACTCATTTGTCAGGGTCCTTTACAGATGGTTTTTTTGACTAACCAGCTGGCTAGCACATACAGCATGGATATGCTGGACAAGGTACAGTTCATATCCCACGTAGGATGGAGAAGGACTGAAGTTTGATCACACTAAAGATGGCTCATGATTTAAAACCTAGTTTATTTCTGGAATTTTTCATTTACTGTTTTAAGGTCTTGGTTGCTGAGGTAACAAAACTAGATAAAGGATACAATACAGTATTTTATGGATATTTGGGTTTCCATCATTTGTAATTATATACTGTACATTGTTGTAGACATCAAAAATGCATAGAGGTAAACATTTTTTGCTGAGAAAGGGTTAATGCGTTTTAATTTTGAAAGACGATGCCAAACTGTTCTGTAGAGGTGGTACCATTTTATACTCTGCAAGAATGCCTGATCCCCGACAGGCTCCCTAAACAATGGGTTGTCAGACGTGGGTTTTCGGCAGTAGAGAAGTGAGAAATGACTGATGAGTCCTTTTTTCAAGGTGGTTTTATTAATACCTAATTTACATTTGGTGTAATTCATGACTGCAGTTCTGTGACATCTATGCAGTTGGTAAGTACCACCTCCACCTGCGTGCTCTTTTTTCAAATATATTTTTTACCCATTGCCCCACTTCACTTCCCCTTTGACGACCATCAGCTTGTTCTCCAAATCTGGGTCTTCACAGTTTGGGTTTGTTTTGTTTTGTTTTTTAATTCTACTAGTGAAATTAGGTTTTCGCATGCTCTCTTAAAGTCAACTTCCACTCCAGGCAGCCATTGATAGAATCTTTCTTTTCCTGTAGTTTTGCCTTTTCCAGAATGTCATACAACATGCTAAGTCTTAGCATGATGATAATACCTTTGAGATTTGTTCATGTTTGTGGTTCAGTAGGTCTTTTTATCATCCATCAGTATTTTGCTGTATCAGTGTGTCACTATGCTAAAGTATAACCGTTGAAAGACATTTGGGTTGTTTACAATGATCGGAGATTATGAATAAAGCCACTAAACATTTGCATACA