Transcript asmbl_14848

Sequence
Transcript Sequence for observation asmbl_14848 of TGE0000329:
CGGGGCCTGGGTGGGGGGTGCGGGTGTGGGTGGGGACCTGCGGCCTTCGAGTCCGCGGCCTTCGAGTCCTGGGGCGGCGGCGGCGGCTGCAGGCACGGGCACGGGCACGGGGCGGGGTGCTTAGGGTGCAGGAGGCGCGCGCCTAGCGGCGGAGTGTGGCGTGAGGCCGGGCCCGCGCCGCCATGAACCTAGAGCGGCTGCGGAAGCGCGTCCGGCAGTACCTCGACCAGCAACAGTATCAAAGTGCTCTATTTTGGGCAGATAAAGTAGCTTCACTCTCTCGTGAAGAACCCCAGGACATCTATTGGTTGGCTCAGTGTCTTTACCTGACAGCACAATATCACAGAGCCGCCCATGCACTTCGGTCACGAAAACTGGACAAATTGTATGAAGCATGTCGTTACCTTGCAGCTAGGTGCCATTATGCTGCAAAAGAGCACCAGCAGGCCCTTGATGTTCTTGACATGGAAGAGCCCATCAATAAAAGATTATTTGAAAAATACTTGAAGGACGAAAGTGGCTTCAAAGATCCTTCCAGCGACTGGGAAATGTCACAGTCTTCAATAAAGAGTTCTATCTGTCTTCTACGCGGGAAAATCTATGATGCTCTAGATAACCGAACCCTGGCTACCTACAGCTACAAAGAAGCTTTGAAGCTTGATGTCTACTGTTTTGAAGCGTTCGATCTTTTAACATCACATCACATGCTGACAGCACAAGAAGAAAAAGAACTTCTTGAATCACTACCCCTTAGCAAGCTGTGTAATGAAGAACAGGAATTGCTGCGTTTTCTATTTGAGAACAAATTGAAAAAATATAATAAGCCTAGTGAAACGGTCATCCCTGAATCTGTAGATGGCTTGCAAGAGAATCTGGATGTGGTAGTGTCTTTAGCTGAGAGACATTATTATAACTGTGATTTTAAAATGTGCTACAAGCTTACTTCTGTAGTAATGGAGAAAGATCCTTTCCATGCAAGTTGTTTACCTGTACATATAGGGACGCTTGTAGAGCTGAATAAAGCCAATGAACTTTTCTATCTTTCTCATAAACTGGTGGATTTATATCCTAGTAATCCTGTGTCTTGGTTTGCAGTGGGATGTTACTATCTCATGGTCGGTCATAAAAATGAACATGCCAGAAGATATCTCAGCAAAGCCACAACACTTGAGAAAACCTATGGACCTGCATGGATAGCCTATGGACATTCATTTGCGGTGGAGAGTGAGCACGACCAAGCGATGGCTGCTTACTTCACAGCAGCACAGCTGATGAAAGGGTGTCATTTGCCTATGCTGTATATTGGATTAGAATATGGTTTGACCAATAACTCAAAACTAGCTGAAAGGTTCTTCAGCCAAGCTCTGAGCATTGCACCGGAAGACCCTTTTGTTATGCATGAGGTCGGCGTGGTTGCATTTCAGAATGGAGAATGGAAAACAGCCGAAAAATGGTTTCTTGATGCTTTGGAAAAAATTAAAGCAATTGGGAACGAGGTAACAGTTGACAAATGGGAACCTTTGTTGAACAACTTGGGGCATGTCTGCAGAAAACTTAAAAAGTATGCTGAGGCCTTGGATTACCACCGTCAGGCACTGGTGTTGATTCCTCAGAACGCATCCACCTACTCTGCTATTGGATATATCCACAGTCTGATGGGCAACTTTGAAAATGCTGTGGACTACTTCCACACAGCCCTTGGTCTTAGGCGAGATGATACATTTTCTGTTACAATGCTTGGTCATTGCATCGAAATGTACATTGGTGATTCTGAAGCTTATATTGGAGCAGACATTAAAGACAAATTAAAATGTTATGACTTTGATGTGCATACAATGAAGACACTAAAAAACATTATTTCACCTCCGTGGGATTTCAGGGAATTTGAAGTAGAAAAACAGACTGCAGAAGAAACGGGGCTTACGCCATTGGAAACCTCAAGGAAAACTCCAGATTCCAGACCTTCCTTGGAAGAAACCTTTGAAATTGAAATGAATGAAAGTGACATGATGTTAGAGACATCTATGTCAGACCACAGCACGTGACTCCAGTCAGTGGTCCTGGTCCCACTGTCCCAGTGTAGGTTAGTATTCCTTCACATCCTCTCCATGGCTTAAGAATGTCCCACTTCCTAACGTGACTCCAAACTGCATCTCTACATTTAGGAACAGAGACCCGCCTTAAGAGACTGGATCGCACACCTTTGCAACAGATGTGTTCTGATTCTCTGAACCTACAAAATAGTTATACATAGTGGAATAAAGAAGGTAAACCATCTGTTATGTCTTTTTT