Transcript asmbl_16737

Sequence
Transcript Sequence for observation asmbl_16737 of TGE0003793:
CAGGCTCCTGCGGTGCTTCACAGTCTGGCTCCGGCGCCGCCCGTCGCGGTCTCGGTTCTGCTCAGCCCGCCTCTGCTCCTGCTCGGCGTCCGGGCTCCCTGTCCGCAGCCATGAACGCTCTCCTCCCGAGTCGAGCCCGCTGTCTTCTAGATTAGTCCCCGCTGCCGTCCCTGGACCGCCTGCACCATGGAGTCGCCCGCCTCGAGCCAGCCTGCCAGCATACCCCAGTCCAAAGGAAAATCTAAGAGGAAGAAGGATTTACGAATATCCTGTGTGTCCAAGCCACCTGTGCCCAACCCTACGCCACCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGATAGGAACTTTGAGGTGGAGGCTGATGACCTGGTGACCATCTCGGAACTGGGACGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCATGCCCAGAGCGGCACCATCATGGCTGTAAAGCGGATCCGGGCCACTGTCAACACACAGGAGCAGAAGCGTCTGCTCATGGACTTGGACGTCAACATGCGTACAGTCGACTGCTTCTATACTGTCACCTTCTATGGAGCCCTCTTCAGAGAGGGAGATGTATGGATCTGCATGGAGCTCATGGACACATCCTTGGATAAGTTCTACCGGAAGGTGCTTGATAAAAACATGACGATTCCAGAGGACATTCTTGGGGAGATTGCTGTGTCTATTGTGAGGGCACTGGAGCATCTGCACAGCAAGCTGTCCGTGATCCACAGAGATGTGAAGCCATCTAATGTCCTCATCAACAAGGAGGGCCATGTGAAGATGTGCGATTTTGGGATCAGCGGCTACTTGGTGGATTCTGTGGCCAAGACGATGGATGCTGGCTGCAAGCCCTATATGGCTCCTGAGAGAATCAACCCGGAGCTGAACCAGAAGGGCTACAACGTCAAGTCTGATGTCTGGAGCCTCGGAATCACCATGATCGAGATGGCCATTCTACGGTTTCCTTATGAGTCTTGGGGGACCCCGTTCCAGCAACTGAAGCAAGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCTGACCGTTTTTCCCCTGAGTTTGTGGACTTCACCGCACAGTGCCTAAGAAAGAACCCCGTGGAGCGCATGAGCTACCTGGAGCTGATGGAACATCCTTTCTTCACCTTGCACAAAACCAAGAAGACAGACATCACTGCTTTTGTGAAGGAAATCCTGGGAGAGGACTCATAGGGGGCAGGGCCTCGGACCCCACTCTGGCCCTCTAGTGCCCCACAGCCCCCTCTGCTGGAGCAGTGCTTGCCCACACCTATAAGCTACTGCCACCCTGGCCTTGGGCATTCCAAGAGGAATCGAGGGGGCTGCTCCCAAGTGCCAAAGAACCAGACTGTCGGGGCCCCCCGCTGGGCCCATGCGGGCCCCACCAGTGCCTCTGTCCTGCTGTTCCAAGTCTCCAGCCCTGAGGCCTTGGACTTGGAGGGGCCTGGATGCCCCTGCCAGACGCTGCTGCCCCTCACAGAAGGCATCCGGTGCTTGTGCACAGGCCACTGCCTTGGCCCAGCCCTGGATGCCACCTGAGTTGTATATTTTTGTATCTTTCGACTGAATGAACTTTGCACACTTCAAGGGTGGCCACACATCTCTCCCAGCATCAGTAGAGGGGACATGGGGATGAGCCACATGAGTCCTCCTGATCCCCCTCTGAGGGAGAAGCCAGAGCCACTTGAGGCCTTCACCCAGCACTGGCAAATGGCCTCTAAGGGGCACCAAGGACACTTAGCCTCTGCCTGCCACCTCTAGGGGTGTTGTTTCACTTTTTAAAAACAAATTTGTCTTTTTTTTTCTTTTGCTTTGTGGGTTTGGCTGGTTTTTCTCGCATGGTTTGGAGCCGATAACTTTTCTGCCACTCCCTAGGGGACCAGCAAGCTGAGACCCACCCTCTCCACTCAGGCTGGAGTCTAGGAGGATGAGCCCAAAGTCTCTGCTTAGAGAGGTATTCTTCTTGGGGATTGGCTTGACAGGGGCTATAGATTTGCTTTTGGTGTTAGAAAAGAAAAAAATGTTTTGAAGGACTACCTGTTCTGGGTTCTATCCCTGGTGGATTGGGGCAGTTACATGATTGCTGTTTTGATTT