Transcript asmbl_16715

Sequence
Transcript Sequence for observation asmbl_16715 of TGE0023634:
TGAGGGCACTGAGGCACAGGTGTGCAGTCCAGCCCAGCTGCGCAGGCCATGCCCCTGATCTTGCGGACTGGTTCAAGCCCTGACTCTGTGGATCTGCTACCACCCTACAGAGCTGGGCCCAAGCCCACCGCTTTCACACTGATGCCTAGGCCCTGACCTTTCTGTAATTCGCTCTTCCTGCTCTGGTTCCTAGTTCCTGCCCTCACAGGGATGTGCCTGCATTCTGACCTCCTACCCCAACCTTAACCGGGCAGACCCCCACTCCAGCTCCTGTTTTCACCCCCTTGGCAGGTGTTCAAAGCCAAGTTCAAAAATTGGGATGACGTGTTGACAGTGGACTACACGCGCAATGCAGAAGCCGTGCTGCAGGGCTCAGGACTCACCGGGAAGGTGAAGCGCGATGCCGAGAAGAAAGATCAGATGAAAGCTGACCTCACTGCGCTGTTCCTGCCCCGGCAGCCGCCCATGGCGCTAGCTGAGGCCGAGCAGCTGATGGAGGAGTGGAATGAGGACCTGGATGGCATGGAGGGCTTCGTGCTCGAGGGTAAGAAGTTCGCGCGGCTGCCTGAGGAAGAGTTTGGCCACTTCTACACACAGGACTGCTACGTCTTCCTCTGCAGATACTGGGTCCCTGTGGAATACGAGGAAGAAGAGAAGAAAGAGAAAGAGGAGGAAAAGGCTGGGGCTGAGGGCAAAGAAGGTGAAGAGGCAGCCACCGAAGCGGAGGAGAAACAGCCCGAGGAGGACTTCCAATGCATCGTGTACTTCTGGCAGGGCCGTGAAGCCTCCAACATGGGCTGGCTCACCTTCACCTTCAGCCTGCAAAAGAAGTTCGAGAGCCTCTTCCCGGGCAAGCTAGAGGTGGTGCGAATGACGCAGCAGCAAGAGAACCCCAAGTTCCTGTCCCATTTCAAGAGAAAATTCGTCATCCACCGGGGCAAGAGGAAGGTGGCCCAGGGCACCCTGCAGCCAAGCCTCTACCAGATTCGAACCAATGGCAGCGCCCTCTGCACTCGGTGCATCCAGATCAACACCGACTCCAGCCTCCTCAACTCCGAGTTCTGCTTCATCCTCAAGGTTCCCTTTGAGAGTGAGGACAACCAGGGCATCGTGTACGCATGGGTGGGCCGGGCATCAGACCCTGATGAGGCCAAGCTGGCAGAGGATATACTGAACACCATGTTTGATACCTCCTACAGCAAGCAGGTCATCAATGAAGGTGAGGAGCCTGAGAACTTTTTCTGGGTGGGCATCGGGGCACAGAAGCCTTACGACGATGATGCCGAATACATGAAGCACACTCGGCTCTTCCGGTGCTCCAACGAGAAGGGCTACTTTGCAGTGACGGAAAAATGCTCTGACTTTTGCCAAGATGACCTGGCAGATGATGACATCATGTTGTTAGACAATGGCCAAGAGGTCTATATGTGGGTAGGGACCCAGACAAGCCAGGTGGAGATCAAGCTGAGTCTGAAGGCCTGCCAGGTATACATCCAGCACATGCGAGCCAAAGAGCACGAGCATCCCCGCCGCCTGCGCCTTGTCCGTAAGGGTAACGAGCAGCATGCCTTCACCCGATGTTTCCATGCCTGGAGCACCTTCCGCAAGGCCCTGGCCTAGGGCGACCATTATCAGCCTGCACTGTCCCAGTCGAAAACTCAAGCTCTGGGTGAGGGAGAGGAAAGGCCTCTGTCCATCCACCACCTGCCAGCAGAGGCTGTATACAGGTGGCAGCCCCTGCCCCAGTCACCCTCCAGTGCCACGGTCCCCAGCAGCACAGCCCAAGCAGTACCAATGGGGGTAACCCTGACTGGTGCCCACAGAGGTCTGGAAAATTAGACTCTTGGTATGAGCTCACATGTAACACCCCTCTTCCCCTGCCAGGGATAAAGCAGATGTGGTTATCCTTTTGAGATATTAAATGCTTT