Transcript asmbl_16711

Sequence
Transcript Sequence for observation asmbl_16711 of TGE0014815:
CGCCGCCCGCGCTTGGCCCGGCCCGGCAGCGAGAACGGCGCCATGGAGGCCACCGGGGTGCTGCCGTTCGTGCGCGGCGTGGATCTCAGTGGCAACGACTTCAAGGGAGGCTACTTCCCTGAGAATGTTAAAGCCATGACAAGTCTGCGATGGCTGAAAAAAATACCTGCCGGAGGAGTTGGCCTCCCTACAGAAGCTGGAGCACTTGTCTGTGAGCCACAACAACCTGACCACACTTCATGGAGAGCTGTCGAGCCTGCCATCACTTCGGGCCATCGTGGCTCGAGCCAACAGCCTGAAGAATTCTGGAGTCCCTGATGACATCTTCAAGCTGGATGATCTCTCAGTCCTGGACTTGAGCTACAACCAGCTGACAGAGTGCCCGCGGGAGCTGGAGAATGCCAAGAACATGCTGGTGTTGAACCTCAGTCACAACAGCATCGACACCATTCCCAACCAACTCTTCATCAACCTCACTGACCTGCTGTACCTGGACCTCAGCGAGAACTGCCTGGAAAGCTTGCCTCCACAGATGCGCCGCCTGGTGCACCTACAGACACTCGTGCTCAACGGGAACCCACTGTTACATGCACAGCTCCGGCAGCTCCCAGCTCTGACAGCCTTGCAGACCCTGCACCTGAGGAACACCCAGCGCACCCAGGGCAACCTCCCCACCAGCCTGGAGGGCCTGAGCAACCTTGCAGATGTGGACCTTTCCTGCAACGACCTGACACGGGTTCCTGAGTGCCTGTACACCCTCCACAGCCTGCGCCGCCTGAACCTCAGCAGCAACCAGATCACGGAGCTATCCCTGTGCATCGACCAGTGGGTGCATGTGGAGACCTTGAACCTGTCCCGCAATCAGCTCACCTCACTGCCTTCGGCCATTTGCAAGCTGACCAAGCTGAAGAAGCTATACCTGAACTCTAACAAACTGGACTTTGATGGGCTGCCCTCAGGCATTGGCAAGCTGGCCTGCTTGGAGGAGTTCATGGCTGCCAACAATAACCTGGAGCTGATTCCTGAAAGCCTCTGCAGGTGCACAAAGCTGAGGAAACTCGTCCTGAACAAAAACCGCCTGGTGACCCTCCCAGAGGCCATCCACTTCCTGACGGAGATAGAGGTCCTGGATGTGCGGGAGAACCCCAGCCTGGTCATGCCTCCCAAGCCTGCTGACCGCACTGCCGAGTGGTACAACATTGACTTCTCACTGCAGAACCAGCTACAGCTGGCAGGTGCCTCTCCTGCCACAGTGGCTGCGGCAGCAGCTGCAGGGGGTGGGCCCAAGGACCCCCTGGCTCGGAAGATGCGGCTACGGAGGCGCAAAGACTCAGCCCAGGATGACCAAGCCAAGCAGGTGCTGAAGGGCATGTCAGACGTGGCCCAGGAGAAGAATAAAAAGCAGGAGGAGAGTACTGACACCCGAGCCCCCGGGGGCAAGGTGCGGCGCTGGGACCAGGGCCTGGAGAAGCCTCGCCTCGACTACTCAGAGTTCTTCACAGAGGATGTGGGCCAACTGCCTGGCCTGACCATTTGGCAGATCGAGAACTTTGTGCCTGTGCTGGTGGAGGAAGCCTTACATGGCAAGTTCTATGAAGCTGACTGCTACATCGTGCTCAAGACCTTTCTGGATGACAGCGGCTCTCTGAACTGGGAGATCTACTACTGGATCGGTGGGGAGGCCACACTCGACAAGAAGGCTTGCTCTGCTATCCACGCGGTGAACCTGCGCAACTACCTGGGTGCGGAGTGCCGCACTGTGCGGGAAGAGATGGGAGATGAGAGCGAGGAGTTCTTGCAGGTGTTTGACAACGACATCGCCTACATCGAGGGTGGAACAGCCAGTGGCTTCTACACTGTGGAGGACACACACTATGTCACCAGGATGTACCGCGTGTATGGGAAAAAGAACATCAAACTGGAGCCTGTGCCACTCAAGGGGGCCTCTCTGGACCCGAGGTTTGTTTTCCTGCTGGACCAAGGGCTGGACATCTACGTGTGGCGGGGGACCCAGGCCACACTGAGTGGCACTACCAAGGCCAGGCTCTTTGCAGAAAAAATTAACAAAAACGAGCGGAAAGGGAAGGCAGAGATCACATTGCTGGTGCAAGGCCAAGAGCCCCCAGAGTTCTGGGGGGCACTGGGTGGTGAGCCCTCCGAGATCAAGAAGCATGTGCCTGATGATTTCTGGCCACCCCAGCCTAAGCTATATAAGGTGGGCCTGGGTCTGGGTTACCTGGAGCTGCCACAGATCAACTACAAGCTGTCTGTGGAACATAAGACGCGACCCAAGGTGGAACTGATGCCGGGGATGCGGCTGCTGCAGAGCCTACTGGACACGCGATGCGTGTACATCCTGGACTGTTGGTCTGATGTGTTCATCTGGCTTGGGCGCAAGTCGCCGCGCCTGGTGCGTGCTGCAGCCCTCAAGTTGGGCCAGGAGCTGTGCGGGATGCTACACCGGCCACGCCACGCCACGGTCAGCCGCAGCCTTGAGGGCACTGAGGCACAGGTGTTCAAAGCCAAGTTCAAAAATTGGGATGACGTGTTGACAGTGGACTACACGCGCAATGCAGAAGCCGTGCTGCAGGGCTCAGGACTCACCGGGAAGGTGAAGCGCGATGCCGAGAAGAAAGATCAGATGAAAGCTGACCTCACTGCGCTGTTCCTGCCCCGGCAGCCGCCCATGGCGCTAGCTGAGGCCGAGCAGCTGATGGAGGAGTGGAATGAGGACCTGGATGGCATGGAGGGCTTCGTGCTCGAGGGTAAGAAGTTCGCGCGGCTGCCTGAGGAAGAGTTTGGCCACTTCTACACACAGGACTGCTACGTCTTCCTCTGCAGGTGCCGTCTCAGCACACCTCCTTTGGCAGGCCCCTACCCTGGTGCTTGGGGGGCCCCTGCTTACTGCCCTCTGACCCTGTAGATACTGGGTCCCTGTGGAATA