Transcript asmbl_16040

Sequence
Transcript Sequence for observation asmbl_16040 of TGE0003765:
CCAGGAGGCTGTGCGCTGCCCTTGCTGCCTTTGGGTTCTTGAGAGCGAGCGCGTGAACGGCTCTCTGCAGTCTAGTCATGGCGCTTCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAGCATTTTTCAGGATTAGAAGAAGCAGTGTACAGGAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCGTATGGACCAAATGGAATGAACAAAATGGTTATCAACCACCTGGAGAAGTTGTTTGTGACAAATGATGCAGCGACTATTTTAAGAGAGCTGGAAGTACAGCATCCTGCTGCAAAAATGATCGTAATGGCCTCTCACATGCAAGAGCAAGAGGTTGGAGATGGCACCAACTTTGTTCTGGTGTTTGCCGGAGCTCTTCTGGAATTAGCGGAAGAGCTTCTTAGAATTGGCCTGTCAGTTTCGGAGGTCATAGAAGGTTACGAAATAGCCTGCAAAAAAGCCCATGAGATTCTTCCTGATTTGGTATGCTGTTCTGCAAAAAATCTTCGAGATATTGATGAAGTGTCATCTCTACTTCATACCTCCATAATGAGTAAACAGTATGGTAATGAAGTCTTTCTGGCCAAGCTTATTGCTCAAGCATGTGTATCTATTTTTCCTGATTCTGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAGATTTTGGGCTCTGGTATCTCTTCCTCTTCAGTATTACATGGCATGGTTTTTAAGAAGGAAACTGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCCTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACGGTATTGATAAAGACTGCTGAAGAGTTGATGAATTTTAGTAAGGGAGAAGAAAATCTTATGGATGCACAAGTCAAAGCTATTGCTGATACCGGTGCAAATGTCGTCGTAACAGGTGGTAAAGTGGCAGACATGGCTCTTCATTATGCAAACAAATACAATATCATGTTGGTGAGGCTGAACTCAAAATGGGATCTCAGAAGGCTGTGTAAAACAGTTGGTGCTACAGCTCTTCCTAGATTGACTCCTCCTGTGGTTGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGACACACAGGTGGTGGTTTTCAAGCATGAAAAGGAAGATGGAGCCATTTCTACCATAGTTCTTCGAGGCTCTACAGACAATCTGATGGATGATATAGAAAGGGCAGTAGATGATGGTGTTAATACTTTCAAAGTTCTCACAAGGGATAAACGTCTTGTACCTGGAGGTGGAGCAACAGAAATTGAGTTAGCCAAACAGATCACGTCATATGGAGAGACATGTCCTGGACTAGAACAGTATGCCATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGGGCACTGGCAGAAAACTCTGGGGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAATGTTGGATTAGATATTGAGGCTGAAGTTCCTGCTGTAAAGGACATGTTGGAGGCTGGTATTCTAGATACTTACCTGGGAAAATACTGGGCTATCAAACTGGCCACCAATGCTGCTGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGACCTAAACCTCCAAGTGGGAAGAAAGACTGGGATGACGACCAAAATGATTGAATGGTTAATTTTTACTGTAGGCAAAGGCTGTAGGTATAGTAGTACTCTAGGAATTGCCTGATCTTTTCCTATTCTTAAATTAAGAGGTGTTTTGTGTTTATATCCTTGGCTGGTTGATAAAATAAATGTGTTGTTACTATC