Transcript asmbl_16016

Sequence
Transcript Sequence for observation asmbl_16016 of TGE0003753:
GGGGTTGCTGTTTTTTTTTGTGGGGGGGTCGGGTTTGTTGGTTTCACTGAAAATTTTAACTACCTGTAAAATCTAAACATGGCTGTTAGTGTCACACCAATTCGGGACACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTCCAAAGGGGGACTTGCTCACGGCCAGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGTCGTTGCTCCAGAGAGAACTGCAAATATCTTCATCCACCCCCACACTTAAAAACACAATTGGAGATAAATGGACGCAATAACTTGATTCAGCAGAAGAACATGGCCATGTTGGCCCAGCAAATGCAGCTAGCCAATGCCATGATGCCCGGTGCCCCATTGCAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCCCCTAGCCTGGTTCCAGCAGAGATCTTGCCGACTGCACCAATGTTGGTTACAGGGAATCCCGGAGTCCCTGTACCTGCAGCTGCTGCGGCTGCCGCGCAGAAGTTGATGCGGACAGACAGACTCGAGGTGTGTCGAGAGTACCAGCGTGGCAATTGCAACAGAGGAGAAAACGATTGTCGGTTCGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTGTGTATGGATTACATCAAAGGGAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCTCCCGCACATCTGCAAGCCAAGATCAAGGCTGCCCAATACCAGGTCAACCAGGCTGCAGCAGCACAGGCTGCAGCCACTGCAGCTGCCATGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACCGCAGTCTTTAACACTGGTATTTTCCAATACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCGTTTCTCCCACCAGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTGTCATCACTAAACAATCATACTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATACCGTCAAGCAACACACACAAAAACCCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTAAAATATGCATACCTAATTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGGTGTAACCATGACTCTATTATGTATTGGTACGTCTGTAGACCAAGATATAATTTTTTAAAAATAAGTTTATTTCTTTCAAGGTTTACAAATAACAAAGGTGCACCTTGTATTTAAAATTGCCATTATAGATGAGAGCGTGCATGCACAGTCATTTTTGTTTAAGAGTAATATTTTTAATGTAATAGATTGTAAGATGTGGTGAGGGAGGGATCTGACAGAGATGAATGTGCCAAGCAAAACCACAACTGTGTATCTTTTAAAGCACATCATGGCTTTAAGTACCATGTTGTTAAGGATTCTCATGAAGTGCCATAGACTGTACATCAAATTAGAGTATTATTTCTTCAGTGTTATTGTTTTCAGAGCCACATTTTGTTGCTTATTTGCTAGTACTAATCAGTCAAAGGGCACC