Transcript asmbl_14950

Sequence
Transcript Sequence for observation asmbl_14950 of TGE0003105:
GACGCCATTTGCTTCACTCGGAGGTAGATTCTTGCTAATTGTCCTAGAGTCCGTATTAATATCGTTCCGGGTCTGCGATCTGTAATTCCTTTATCTCACTGGCCTCTCGGAGAAGTCGCCGTTGCGAAGGCACCACCAGATAAGAGTAGGAGACGCCATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGGCGTAGAGGTAAGAATGAGAATGAATCTGAAAAAAGAGAATTGGTCTTTAAAGAGGATGGGCAAGAGTATGCTCAAGTAATCAAAATGTTGGGAAATGGACGATTAGAAGCAATGTGCTTCGATGGTGTAAAGAGGTTATGTCATATCAGAGGAAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGACATTATATTGGTTGGTCTACGAGATTATCAGGATAACAAAGCGGATGTAATTTTAAAATATAATGCAGATGAAGCTAGAAGTCTGAAGGCATATGGCGAGCTTCCAGAACATGCTAAAATCAATGAAACAGATACATTCGGTCCTGGAGATGATGATGAAATTCAGTTTGATGATATTGGAGATGATGATGAAGACATTGATGATATCTAAATTGAACTCAAAGTTTCTGAGTATTGCTCTACGATTTGGATTTTGGCCATCACCTGTTAAGAAGACCAAAACTTCATTAAACATGAATGCAGTTTGTTAGGACACACTGATTTATTTCATTGTTTAAAGTATTTATTATATTTCTTTAAAAACCGCCAAAGCTGAATTATCTTAAGTGAAATGTTAACAATTTATTCTTTTGATGTAATAGAACTTAGTGGTAGACCACAGTATCTGTTATTTAAAATAGTAGGAGAAAGTATATTAATAAAAGAAGGCTTTAATGGATATTTTTAATAAATTGCTTTATCATAGACTGCGTTAAGCCCTAGGGCCAACTAGTCTGTTTAGAAACTCTTTCTATATGTTCCAGTTACCTAGATGTTCTCTTGAGATTTTAGTTTAAATTTAAGGAAGGCAGAAATCTACATCTGAAGTCAAGAAAAGGGGCTATTTTCATATTTATGTAGCTGTATGTATTTTTATACTGTTTGATAACATTCTTTTCATCATTTTATGTTGTCACCATCAAAAAAAGCATTTCAAAATACAGCTTTTAGAACATGAGTTTGAGTAGTAATTTTGAATTTGTAAGATTTGTAGTGGCAAAAATTCAATGCTAATAATTAATGCCCAATTATCTTAATATTGGAAATATTGATATATTAGTTGATAGTGTTTTTCACTTAATATGTGGAAATTTTCTTAAGTAAGACAACTTTTAATGGCAACTTTTAGTGGAATAATTTTTACTATAAAAAAATGTTATGTTAAAATATGTCATTTTATTGTCAAAAGTCATCTGTATTTGTAACCTATAGTTTTG