Transcript asmbl_14074

Sequence
Transcript Sequence for observation asmbl_14074 of TGE0003675:
GGTTTTTACTGATAGGTGCCATATTCAGGACAGAGCAATTCATTTCTATTCTGTTCTCCCCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTT