Transcript asmbl_14026

Sequence
Transcript Sequence for observation asmbl_14026 of TGE0008082:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGGTAAGCCGGTGCCTTTGTCCCCAGGGGGCCGTGTCCCGGCCTGTCCTCTCCGACTCCGTTCTGCTCTCTCTGCTGTGCCCCCAGCCCCGGCATCGGCGTGGCCAGTCCCTGGGTGAGCCGAAGATAGCTCTGCCCGTTACGAAGAGTGCTGGCTTTGCCTCCTCTTACAGGGGAGTCTTCTAAGCTCTTGTTTCTCTGGAGGCGTCCGCAGCGTGTCACCAAAAGCCCCCTACTGAGGCACAGTCGGCAGGCCATTGCTTTGGTGTGCCTTCGGGTTCAAGCCCGCCAGAAGTGTGCCAGACCTCGGGGCGAGAGGGTGGGGCGTTGCTGGCTGTGTGTCAGGGGCCTCCCTACAAGGGTTCTCTGGGAGATCCCCAAAGTGCCACTGCCCGCACACCGTCTGCGAGACACAGGGCACCGCATCTTCCATGGCATTCAGGCCACTGAGGGAGGTGCCGGGAAGAGAAATGAATGCCAGTCGTGTTTACTGACACTAAAACTTCGGAAATGTTTTGGGAATTTAGACGCTAAAAAAATAAAAAGGTACTGATAGCTATTGAAATCTGAGATAAAGCTCTTTAAAGCTTAATCTTATATTTTATGATGAAATCTCCACTGGCACTTAGAATTCCCCCCTTCTAAATCATTTGACGTTTCTGTGCTTATATAAAGAACACTCTGCCGTGTAATTTGTATTCTTACGGGATAAAGGGGCTGGCTGTGGCACGCATGCGCAGGAG