Transcript asmbl_14007

Sequence
Transcript Sequence for observation asmbl_14007 of TGE0003662:
GGAAGTGTCGCTAGGGCCCCTCCGAGGGCCCCTGGGGAATTGTGTTTGTTTTCCTCCTGCCTCATAGAAACGTTTGCCAGTTCGTAGTGGAACCTTTAAGTGGGTCGTTTCCTACCTCTGCCTTGGAGCTGGAGACCCCGCAGGGAGCGAGGCGGACTCTTCATTCACGGTCCTGCCTTGAGGTTCTGAGAACTTCCCCCTCTATCTGGTGTCGCTGCCCGGAGCCCGCGGGCCACAGCGAAGGGGCGGCTGCAGGGTGTGGAAGGGACCGGAAGCTCGTTGAGCCAACATGGCCGTCCTCTCCAAGGAGTATGGCTTCGTGGTGCTGACGGGGGCCGCCAGCTTCATCATGGTCGGCCATCTGGCCTTCAATGTGTCCAAGGCCCGCAAGAAGTACAAGGTGGAGTACCCCACCATGTACAGCGCAGACCCCGAGAACGGACACCTGTTCAACTGCATTCAGCGAGCCCACCAGAACACGTTGGAAGCGTATCCGGCCTTCTTGTTTTTTCTAGCTGTTGGGGGTGTTTACCACCCGCGAGTAGCTTCCGGTTTGGGCCTGGCCTGGATTGTCGGACGGGTTCTCTACGCCTACGGCTATTACACAGGAGACCCTAGCAAGCGGAGCCGGGGGGCGCTGGGCTCCGTCGCCCTTCTCGGCTTACTGGGCACCACCGTGGTCTCGGCCTTCCAGCACCTCGGCTGGCTTAGACCTGGCTTGGGCAGTGAGTGCAAATCCTGCCATTAAAGAATGATAGGGTGTCTGAAAACTCTGATTTCGTCCCGAGTGACTTTTATTTCCAGTTACAGTTTTTCTAAATATAATAAAAATTTATCTGGCATCAGCCTCATACGTAA