Transcript asmbl_13852

Sequence
Transcript Sequence for observation asmbl_13852 of TGE0003645:
GAAAAATCCGCGAGAAGGTGGTGGAAGAAGATGGCGGTGCTAGGGCCGAGTTTACAATCTTTTTGAATAGACTAGTCCAGTAACTGTTCGGGTCATGGCGTCAAACTCAACTAAGTCTTTCCTGGCAGATGCAGGCTATGGAGAACAGGAGCTGGATGCTAACTCTGCCCTTATGGAATTAGACAAAGGTCTGAGATCTGGCAAACTTGGTGAACAGTGTGAAGCAGTTGTTCGCTTTCCCAGGCTCTTTCAGAAGTATCCATTCCCTATTCTCATCAATTCTGCATTCCTAAAGTTAGCTGATGTTTTCAGAGTTGGAAACAATTTCCTGAGGCTCTGTGTTCTTAAAGTTACTCAACAAAGTGAGAAGCATTTGGAGAAAATTCTAAATGTGGATGAATTTGTGAAGAGAATTTTCTCTGTGATTCATAGTAATGATCCTGTAGCAAGAGCCATCACACTCCGCATGTTGGGAAGTCTGGCATCAATAATTCCTGAAAGGAAGAATGCTCACCATAGTATTCGTCAGAGTCTGGATTCACATGATAACGTAGAAGTTGAAGCTGCTGTTTTTGCTGCTGCAAACTTCTCTGCACAGTCAAAGGATTTTGCTGTAGGAATCTGTAACAAAATCAGTGAAATGATTCAAGGCTTAGCCACACCAGTAGACTTGAAGCTAAAGTTGATCCCAATCCTACAGCACATGCACCACGATGCGATCCTGGCTTCCAGCGCTCGTCAGCTGTTACAACAGCTAGTCACGTCCTATCCTTCTACCAAAATGGTGATTGTTTCTTTGCACACTTTTACTCTGCTTGCAGCTTCATCTTTGGTGGATACACCTAAGCAGATTCAGCTTCTCTTACAGTATTTGAAGACTGACCCCAGGAAAGCAGTAAAGAGACTTGCTATTCAAGATCTGAAATTACTTGCCAATAAAACACCGCATACTTGGACTAGGGAAAACATTCAGGCACTCTGTGAATGTGCCCTCCAGACTCCTTATGACAGCTTAAAACTCGGGATGTTGTCTGTCCTTTCCACACTGTCAGGGACTATCGCTGTCAAACATTACTTCAGCATAGCTTCGGGAAATGTGGGTTCTTCGCCTAGATCCTCTGATTTAGTCAAATTAGCCCAAGAGTGCTGTTACCATAATAACAGGGGCATTGCAGCTCATGGAGTCAGAGTACTAACTAATATAACTGTTTCTTGTCAAGAAAAAGACCTTTTGGCACTGGAACAAGATGCTGTTTTTGGCCTGGAAGCCCTTCTGATACTTTGTAGTCAAGACGATAGTCCAGGTGCTCAAGCCACTTTAAAGATTGCTCTGAACTGTATGGTGAAGCTGGCCAAGGGCAGACCCCATCTTAGCCAGTCAGTGGTTGAGACCTTGTTGACTCAGTTGCACAGTGCTCAGGATGCTGCCCGGATCCTGATGTGCCATTGCCTGGCTGCCATTGCCATGCAGCTGCCGGTGCTGGGTGATGGAATGCTGGGTGACCTCGTGGAACTCTACAAGGTGATTGGACGATCAGCCACAGACAAGCAGCAGGAACTTCTGGTGAGTTTGGCCACTGTGATTTTTGTCGCCAGTCAGAAAGCACTCTCTCCTGAGGTAAAGGCAGTAATTAAACAGCAGCTCGAAAGTGTCTCCAATGGGTGGACTGTGTACCGAATCGCCAGACAGGCATCCAGAATGGGTAATCATGACATGGCCAAAGAGCTTTATCAGAGTTTGCTGACTCAGGTTGCCTCAGAACATTTCTACTTCTGGCTGAATAGTTTGAAGGAGTTCTCACATGCAGAACAGTGTCTCACTGGATTGCAAAAGGAAAATTATAGTTCAGCACTTTCTTGCATTGCTGAGTCTTTAAAATTCTACCACAAAGGGATTGCATCCCTAACGGCTGCCAGTACACCACTGAATCCTTTAAGTTTTCAGTGTGAATTTGTAAAACTCAGGATTGACCTTCTACAAGCCTTCTCGCAACTTATCTGTACTTGTAATAGCCTAAAGACAAGCCCCCCACCTGCAATTGCCACAACAATTGCCATGACCTTAGGGAATGACCTTCAGAGGTGTGGTCGCATCTCCAATCAGATGAAACAGTCCATGGAAGAATTCCGAAGCCTTGCTTCCCGATATGGAGATCTTTATCAGGCATCTTTTGATGCCGATTCAGCAACTTTGAGAAATGTAGAGCTACAGCAGCAGAGCTGTTTGCTGATATCTCACGCAATAGAAGCTCTGATTTTGGACCCGGAATCTGCAAGTTTCCAGGAATATGGATCTACTGGAACAGCCCATGCTGATAGTGAATATGAGAGAAGAATGATGTCTGTGTATAATCATGTCTTGGAGGAGGTGGAATCACTCAATCGGAAATATACCCCTGTTTCTTATATGCATACAGCATGCCTCTGCAATGCCATCATTGCTTTGCTGAAAGTTCCTCTTTCATTTCAGAGATATTTTTTCCAGAAACTGCAGTCTACCAGCATTAAGCTTGCTCTGTCACCATCCCCACGGAACCCTGCAGAGCCCATCGCTGTCCAAAATAACCAGCAGCTGGCGCTGAAGGTGGAGGGAGTGGTTCAGCATGGATCCAAACCAGGACTTTTTCGCAAAATTCAGTCTGTCTGTCTGAATGTTTCTTCCACGCTACAGAGTAAATCTGGACAAGACTACAAGATACCCATCGACAATATGACCAATGAGATGGAGCAGAGGGTTGAGCCTCATAATGATTACTTTAGTACTCAGTTTCTGTTGAACTTTGCTATCCTTGGAACACACAATATTACAGTGGAATCTTCAGTGAAAGACGCCAATGGTATTGTATGGAAGACTGGTCCCAGAACTACCATATTTGTCAAATCCCTGGAAGACCCTTATTCCCAGCAAATCCGCCTACAACAGCAGCAAGCCCAGCAGCCATTACAACAGCAGCAGCAACGGAATGCCTACACGCGATTTTAGCCACGTGACGAGTGTACTACAGGCTTTACAGGAATCGATGAAATTGTCAAAAATAGTTTGCTTTTCCACATGGATTAAGATATGAAAGTTTTAACGCAGACTCTGTTTACTCATTGGTTTCTGCAATGTAATCTGAAAAATGATTTTTTTTACCTTAAAAATTTCATTCGAGAGATATTTGGGTTACTAACCAGAAAGATTTTTTTCCCTTGTTCCTTTAACCAAGTCCTTTATCTCATATTTAACATTTTCATTCTTTTATTAGTGTTTTTACTGCTGCTGAGCCTTTTCTTTTTCTTTCAAGAAAAGTCACATATTGGGATCACTGAATTAGTAAATTTGACTGTTTCTCTACCAAAATATACTACTTGCTGCTTGACACAGGCCTGTAATTCTGAGCTATGCCTTGGGGAGTTCTGACCAGTAGGGTACAGGGTTCACCCGTAGTAGAAGAAACTGAGTCTTCCCGTGGGTGGACTTAGAAATGTCCCCTGAAACGTCCAGTTTCTGGGTTACGAGAGCAGGCAGTCTAGCAGAATTGAGACATCCTGCTATACATATTATTTCAACTACTTACCTATCTGTTCTGTGCTAAAGCAATCTTAATTTATTGTTTTAGTATTTAATTGACCCAAAGAGCAGCTAGCAATTACATAGGAAGATTTGGAGATTAATAATTTTTTTTTTATTATGCGTGTGATTGTGTAGACTTTGTACATTGTTTCTAAGAGTGAAAAAAATCACTCACATTTAATATCTTATTGTTTTAAGGTAGGAGGGCAGATCTTTTCCTTTGATTGATTTAGTTTCTTCTTGGCAAGTTCTGTAACGCTAGACTTGATTGTCTAGAAAGGACCGTCTCCTTATAACCAACCTCAATTAGTTGAGATGCTCAGGGAATAGAAGTTTTCTGGTTAGCCAGAAAACTCCTTTTTTCTATTTCAATACTGGCTGAAAACCATTGTAAAATCTAATAATAGTATGCTTTCTTGTCTTAACACAGTGCAGTAGATAAAATTTAACTATTCTTTCTTGATTTGGGATCAGTCAGTGCTTTGGGATCATGATTTCTAAACATCAGGGATCACAGATTGCAGATATCGATGATATGGTCACTTAGGCTGGAATCAGCTCTGAATGTGAAGCAGACACATT