Transcript asmbl_14840

Sequence
Transcript Sequence for observation asmbl_14840 of TGE0000327:
GGGGCGGGGCGCGCGAGGAGGACGGGGCGGAGGCCGCGCGGACCGGGGCGGGCGGAGCGGAGCTCGGCGGGCGGCGGCGCTCGGGGCGGGGCGCGGCGGTTCCGGCCCAGCCATGGCGGACGAGGCCCCGCGGAAGGGCAGCTTCTCGGCGCTCGTGGGCCGCACCAACGGCCTCACCAAGCCCGCGGCCCTGGCCGCCGCGCCCGCCAAGCCGGGGGGCGCGGGCGGCTCCAAGAAGCTGGTCATCAAGAACTTCCGAGACAGACCTCGGCTGCCCGACAACTACACGCAGGACACGTGGCGGAAGCTGCACGAGGCGGTGCGGGCCGTGCAGAGCAGCACCTCCATCAGGTACAACCTCGAGGAGCTCTACCAGGCTGTGGAAAATCTCTGTTCTCACAAAGTCTCCCCAATGCTCTACAAGCAACTGCGTCAGGCCTGTGAAGACCACGTCCAGGCACAGATCCTTCCGTTTAGAGAAGACTCACTAGATAGTGTTTTATTTTTAAAGAAGATTAACACGTGCTGGCAGGACCACTGCAGACAAATGATCATGATCAGAAGCATCTTCCTGTTCTTGGACCGCACCTATGTGCTGCAGAACTCCACGCTGCCCTCCATCTGGGATATGGGATTAGAACTGTTTAGAACCCATATTATTAGTGATAAAATGGTTCAGAGTAAAACCATTGATGGAATCCTACTGCTGATCGAGCGCGAGAGGAGCGGCGAGGCCGTGGACCGGAGCCTGTTGCGGAGCCTCCTGGGCATGCTGTCTGACCTGCAGGTGTATAAAGATTCATTTGAACTGAAATTTTTGGAAGAGACTAATTGCTTATATGCTGCCGAAGGCCAAAGGTTAATGCAGGAAAGAGAGGTTCCAGAATATCTTAACCATGTAAGTAAACGCTTAGAGGAAGAGGGAGACAGAGTAATCACTTACTTGGACCACAGCACACAGAAACCACTGATTGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGAGCTGGAGCGGACGTTGGACAAGATCATGATCCTGTTCAGGTTTATCCACGGTAAAGATGTCTTTGAAGCATTTTATAAAAAAGATTTGGCAAAAAGACTCCTTGTTGGGAAAAGTGCCTCAGTCGATGCTGAAAAGTCTATGTTGTCAAAGCTCAAGCATGAGTGCGGTGCAGCCTTCACCAGCAAGCTGGAAGGCATGTTCAAGGACATGGAGCTTTCGAAGGACATCATGGTTCATTTCAAGCAGCATATGCAGAATCAGAGTGACTCAGGCCCTATAGACCTCACAGTGAACATACTCACAATGGGCTACTGGCCAACATACACGCCCATGGAAGTGCACTTAACCCCAGAAATGATTAAACTTCAGGAAGTATTTAAGGCATTTTATCTTGGAAAGCACAGTGGTCGAAAACTTCAGTGGCAAACTACTTTGGGACATGCTGTTTTAAAAGCGGAGTTTAAAGAAGGGAAGAAGGAATTCCAGGTGTCCCTCTTCCAGACACTGGTGCTCCTCATGTTCAACGAGGGAGATGGCTTCAGCTTTGAGGAGATAAAAATGGCCACGGGGATAGAGGATAGTGAATTGCGCAGAACGCTGCAGTCCCTGGCCTGTGGCAAAGCACGTGTGCTGATTAAAAGTCCCAAAGGAAAGGAAGTGGAAGATGGAGACAAGTTCATTTTTAATGGAGAGTTCAAGCACAAGTTGTTTAGAATAAAGATCAATCAAATTCAGATGAAGGAAACTGTTGAGGAACAGGTTAGCACCACTGAGAGAGTGTTTCAGGATAGACAATATCAGATTGATGCTGCTATCGTCAGAATAATGAAGATGAGAAAGACTCTTGGTCATAATCTTCTAGTTTCTGAATTATATAATCAGCTGAAATTTCCAGTAAAGCCTGGAGATTTGAAAAAGAGAATTGAATCTCTGATAGACAGAGACTATATGGAGAGAGACAAAGACAATCCGAATCAGTACCACTACGTGGCCTGACGCATCTGCAGACGGTTCCCCTTCATGAAACACTAGAATGTACCCTCAGAGCAGGAAGCACACCTGTGCCATTTCTGGGACTCTGATTGATCCAGCTGTGGACATTGGAAGGCGAAGGAAGGGAGGTGGCTCCTGGGTCATCTTTCACAAGGCTCAAGACTTCAACCTGCAGATGTATCTTTTTCCCTCCAGTTTTTCCTCTAGTTCTTTTAGGCATTTAAATTGTTTCTGTTACTCTGTGCAAAATAACTTTGAGATTGGACAAGAAGATGTTACTAAAGAGAAGTTCCTTTAAAAGGTCTTGTTCTTGTGTCAAAAAGCTGCAAGTTTGGTTTGTTCTCGTGTGTGATCATGAGTGCACAATGAAGAAGACCCTAGATGCTGCATTTTTTAGCTCTGAAGATTCCTTAGGTATCCCTGAAGACAGCTCGCTCAGATGATCAGCATTTAGAGTGAAAACAAGGGCCCTTCATGGGTGAACATTAGAAAGAGCCAGGGTTCAAAGCTGGCGAATGGATGACGCACCCTAGCCACTGGCCCCTCTCTGTTTCATGTATTTCCAAAAGTTGTAAACTTTGATGGCTGATTTTTCGTAAGTCAGGTTTCTAAGTGAGCTCCCTGAGGTGCCAAGGCCATGGTGTCCGCCCTGCTGCGTCTGTTCGTCAGCTGAGTTCCTTGTGAATCTCTGTTTTAGGGTTTGGGGCTAGTGTGTTTGTGTTTCCATTCTAAGATTGAGTCTGGCAGTCCCTGTTTTTTTGCATTGGGGTAACTGCTCTTTGATTTTTTTTAATTGCAGTATTTGTGTGATTGCAATAATAAAGTTTGGTTTGGTTTTTACAGTCATGCGCAGGGACGATCCTTGTTCTCTGCTGTAAACTGTAAAAAGTTTATGGAGACTTAAAGTCTTGATGTTGTGAAGCAGAGGTTATTTTGTGGAAAGATTAAAAGGATTTTGTTGGTACCTGGTTTTGTGTTGTGTATATATACATGAGGTTGAACAGTGAAAGGAAAGTTCAGTAGTGATGTTAGAAGGGTAACTATGACAAAGATACTTTTGAGATAACATTTAAAAGTACTTTATATTTTACATAATAGCATGTTTCATTTTGATTAAAAGCTACCAAAGGAATTTTGATCATGGCATAAGTGTTTAAAGCAATATTTTC