Transcript asmbl_13090

Sequence
Transcript Sequence for observation asmbl_13090 of TGE0003604:
CGCCAGTAGGGTCTCTTTCCCGGGGCCTGCGCCTGATTCTCGGACCCAAATCTCCCGACTCGGTGTCCAGAATCCCCCAGTGTGAAAGCCTGAGGCTTCTGATCACATCGGCGTCCAGGTCCTGAGTGCTCGTCTTGCTTCTTTTTCACAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGTTGGCACCGTTCTGACCCCACCCAGCACTCAGTGCCCCCCGTGCCCTGCTACTCTCTTGAGGCTCCTTTTGAGCCCTTGATGGGCAGGCACGTGCTGCACTGAAGTGCCCGGGTAGTTCAGACCCTCTGCTTTGGGCAGGTGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTTGGCCGAGCCCGCCGGCTAGTTTGAGAAGCCAGACTAGCTGTTGGTGAATGTGAACGCTCTGGGTAAGGCTCAGTGTCTGCAGCGGTCCCAGACCCGTTCACCTGCCCTTCGGACCCAGGGCTGGACATGACCTGTTCTGTCCCCAAAATGCAGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACAGCTTAATAAACCATACTGTTACCATTACCTGTCTGCCTGTGACCAAGGGGAGAGGGAGGTATTTTGACAGCTGTCATTGCATGCCACAGCACAGTGAAGGACAGTCATTTTACCCAAACTGCAAGGAAAGCCATTGTTATTGCCTTCAAAATTCTACAATCTTACTCCAATTTATTGGATATTTATGTTGTGATAGTCGGGCTGCTAACCTGGACTTGAAGCTTTTCTAATAACCTTGAGGGGGAGGGACAGATCAGGGCTAGGCTATGTGCTTCTGCTGCTTATGGAGTGGAAAGGATTAGGTGTTTCA