Transcript asmbl_12615

Sequence
Transcript Sequence for observation asmbl_12615 of TGE0023517:
CGCAGAGGTCCCTGTGACCCCAGACCAGGCGCTGTCCCCGCCCGGCCCTCGTGTGCAGGACTGCGCTCGGGCCCTGCCAGAGCCCCGGTTCCGCGCGGCCGATGTCCCAGCCGCCGGAAGTTGCCCGAGGCTCGCCGAGCGCCTCTGAGGAGCCCGGCGTCGCGCAGTGAAGGCAGAGTGGCCACTGCAGTGGGTGTAGATGTGCCTGACGAGATGAAGAGCCGAATCCCTGTGGTGCTTTTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCCAGAGACCACCTACACCAAACAGCTGTGCCTGAACTGAAGCTCCTCTGCGGGGCAGATGTCCTGAAGACCTTCCAGACCCCTGACCTCTGGAAAGACGAGCACATCCAGGAAATAGTGGAGAAGTTCGGCTTAGTGTGTGTGGGCCGGGTAGGTCACGACCCAAAGGGGTACATCTCAAGCTCCCCCATCCTTCAGAGATACCAGCACAACATTCACCTGGCCAGGGAGCCTGTGCAGAACGAGATCAGTGCCACGTACATCAGGCGGGCCTTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTCCCAGACGCTGTCATCGCCTACATCAAGGACCACAACCTTTATACCAGGGGCAGTTCCTGCAAAGGCAATAACACCCAGAACAACTTAGGAAAGACAAGCTAGGGAGGGCCAAACCCTCCTCCACCAAGCTCCTCCTGAGGAGAGGGCCGTTAAGGTCTTTCCTTTTTTTCAGCTTTTTCCTTTTT