Transcript asmbl_12187

Sequence
Transcript Sequence for observation asmbl_12187 of TGE0003561:
CGCCGCCGCCGCCGCTGTTTCGTAGCCGGGGCTGCGGCCGCAAGAAGAAGGATCTCCCTCTCGCTCCCCGCCGGCGCCTGGCCCGCCCGCTACGCCCCGACGCGTCTCCCATGCCTGCCCCCGGCCCGGCTGCCGACGGACGTCGCGTCAGCGCCCGGATTTAACACGGAAGCCCGGGTCGGGGGCCGCGGGGGGAGGACGAGGGAGACCCGGTAGGTCCCGCGCCCTTCTCGGCCCGGCGCGGCGCCTCGGCGGGAGCCATGACCTCGCTGACCCAGCGCAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGCAACGCCGCCGACAAGGAGCGGGCGGCGGGCGGCGGCGGCGGAGGCAGCGGCGAGGACGACGCGCAGAGCCGCCGCGATGAACAGGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGCCTCAAGGACCGAGAGGGTTACACATCTTTTTGGAATGATTGTATATCATCTGGATTACGTGGCTGTATGTTAATTGAATTAGCATTACGAGGAAGATTACAACTAGAGGCTTGTGGAATGAGACGTAAAAGTTTGTTAACAAGAAAGGTGATCTGTAAGTCTGATGCCCCAACAGGGGACGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAGACTCAGCCTCCAGAAACAGTCCAGAACTGGATAGAGTTACTTAGTGGTGAGACGTGGAATCCATTAAAACTGCATTATCAGTTAAGAAATGTGCGGGAACGATTAGCTAAAAACCTGGTAGAAAAGGGTGTACTAACAACAGAGAAACAGAACTTTCTACTTTTTGACATGACGACACATCCCCTCACCAACAACAACATTAAGCAGCGCCTCATCAAGAAGGTTCAGGAAGCTGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAAGCGCTTGCTGGCCCTCATTTACCTAGCCCATGCCTCCGATGTTCTGGAGAATGCTTTTGCTCCGCTTCTGGATGAGCAGTATGATTTAGCTACGAAGAGAGTGCGGCAGCTCCTTGACTTAGATCCTGAAGTGGAATGTCTGAAGGCCAACACCAACGAGGTTCTGTGGGCGGTGGTGGCAGCATTCACCAAGTAACTCTGCTCAGAATGAAGTATTCTCCTTCCTCTCATGTAAACCAGTAGTTTTTCTTCTATTGACTTCTGGTTTTCTGCAGTTTGTATTTTCCCACACTATAATTGGCTTTTATTTTATGAAATAGTAAGTGGCTTTTTAAAAATATATATATATGTATGCAGGATTCTGCTGGTACGAGAGGCCTTCCTCTTTCTGTTTTAAAAAAAGTTTTACTGCCATATTGGCATTCCATTCCTTGTTGCCATTCTCACCATTACCTGTTTGGGGTTTCTGGTATGCTTTGACTTTCAAAGTACCTCCAGTCTCCTTACATGCACATCTTTTGGATTACCTCAGGTTGAGTTGTTCCCACATGTGCATGCACATCTCATATTCTGCCTACAGTTCAGACGGAAGTCACAAAAAGGCCTTTAACTCACCAAAGGTAAATATCTTTATCTATTAGGACATTTTATACATAGACCTCAGTTGAGATGTATACTTAGCAAAATTATTTTTAAATTGAAACAACACAGTAAATAATATAAAATGCCCCTTGGATTTTGCTTCCCATACGAATCTATTATAAGACTTGTTATAATTTTAACTATTAAATCACAAAGGTCCAGTCGTTTCACAAAGCCAGTTTGGGATAGGCTGCATTCCAGTTATGCTGTATATAGTTTGAATTATATATAAATTGCCCCTTCTGGCCACCCCACCTCCATCTTAGTATTTTGCAAGATTTAATTAGTTGCACACCTGGTGCCCCTCACTTGCTTTAGTCATTATTTGATGGCAAAATAGACCCCTCATCATTGAAGGAGAGAGAGGTGTGTCTGGTCCTGATATTTTTTTAGCTGTGCCATTCATGGCACTCTTTGCCTATGCATCTCCTTTTTGGAATGATTTTTGAGTCTTACTGTTTTTATCATTTCTGTAGGGAAGAGGCTTGTGACCAGTACTAATCTTGAGTACAGTTTTTTCTTTTTTTGACCATAAGTAAATTAATGTCTGCTCTTAAATGTCATTTATCGACTCACACTTTCTTGGGGAAAAAAATTAAATGTCAGTCCTAGCAGATTTTGCATGTAAATTGTTAGCAAGTGATGACTACAATTCAGATGATTAAGAATTTTGTAACAGAAGCTCTGCTATGTTTTAATTTTTATATACAATTATGATAATTAGCACATTGTAAGAATATAAACCTTTGCTTTTTAAAGTTTATTTTTACTATTTCTTTATCACTGTTTATCATATCACCATTGGTTTCATAATGTAAATACTATATATTGAAAAAACGTCAAATTTTGTATTACTGTAGTTCATGTTAATAGTGGGGCTTTCAGGTGTTTAGAGATTTTTTTGGTTAACAGTCAATGCAAAAGTACTAGATGGTGTATAACTCTAGAGTTGAATTTTAAGGGATTCTCTAATCTGTATACTACCTTTTTAACTGAAGTAATAAAATAAACTATGATCTTGAAAGTGCC