Transcript asmbl_11879

Sequence
Transcript Sequence for observation asmbl_11879 of TGE0003554:
CAGGGACCGCCTACACCTGCGACGGACCACGGAGCAGCACGTGCCGGAGGTGGGCGTCCAGGTGAAGCGGAGGAGGACGGCGTCGCTGAGCAGCCACGAGTGTCCGCTGTACCCGAGGCGGTCCCAGCAGCAGGAGCCCGTGGTGGACTTCCAGGCGGAGCTGAGGCAGGCCTTCCTGGCCGAGACCCCGAGGGGTGGCTGAGGCCATCCTGGACGTCCAGGCCCCGTGCTCTGCCGCCGCTGCCCGCTGCCCGGCTGGCGTTGTCTGTGGCAGGACCTGTGCCGTCCCTGGTCTGTAGCCCTCCCTCAGGTCGGCGGTCCCGAGCTTCACCGCGAACGTCGGATCCGGTGGGCCTGCAATCATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATCGACTACCGCATGCGCTGCATCCTGCAGGACGGCCGCATCTTCATCGGCACCTTCAAGGCCTTCGACAAGCACATGAACTTGATCCTCTGCGACTGCGACGAGTTCCGGAAGATCAAGCCAAAGAACGCGAAGCAGCCGGAGCGTGAAGAGAAGCGGGTTTTGGGTCTGGTGCTGCTCCGAGGGGAGAACCTGGTCTCCATGACGGTGGAGGGGCCGCCCCCCAAAGACACCGGCATCGCTCGTGTGCCCCTCGCCGGAGCTGCAGGAGGCCCTGGAGTTGGCAGGGCCGCGGGCCGAGGAGTGCCAGCCGGCGTCCCCATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCCGAGGGGTTGGGGGACCGTCCCAGCAGGTGATGACCCCACAGGGACGAGGCACTGTGGCAGCTGCGGCCGTCGCCGCTACCGCCAGCATTGCCGGAGCCCCAACGCAGTACCCACCAGGTCGGGGGACGCCCCCCACCCCTGTGGGCCGAGCCACCCCACCGCCAGGCATCATGGCTCCTCCCCCTGGCATGAGGCCACCTATGGGCCCACCAATCGGCCTTCCCCCGGCCCGTGGGACACCGATAGGCATGCCCCCCCCAGGCATGAGACCCCCGCCACCAGGAATCAGAGGCCCGCCTCCCCCGGGAATGCGCCCCCCGAGGCCCTAGGACGCTGTCGGTCCTCGGTCACCCCCGCAGTGCGTCTCGTGAAACCGTGTAGAGTGTTCGTGAGCCTTTGTTTCCTCTGCCGCCTCCGTGTTCGCCAATAAACGCATAAGCATGTCCACTGCGA