Transcript asmbl_11878

Sequence
Transcript Sequence for observation asmbl_11878 of TGE0003554:
CAGGGACCGCCTACACCTGCGACGGACCACGGAGCAGCACGTGCCGGAGGTGGGCGTCCAGGTGAAGCGGAGGAGGACGGCGTCGCTGAGCAGCCACGAGTGTCCGCTGTACCCGAGGCGGTCCCAGCAGCAGGAGCCCGTGGTGGACTTCCAGGCGGAGCTGAGGCAGGCCTTCCTGGCCGAGACCCCGAGGGGTGGCTGAGGCCATCCTGGACGTCCAGGTAGCCGCTTCCGAGTGCAAAACAGGCCCCGTGCTCTGCCGCCGCTGCCCGCTGCCCGGCTGGCGTTGTCTGTGGCAGGACCTGTGCCGTCCCTGGTCTGTAGCCCTCCCTCAGGTCGGCGGTCCCGAGCTTCACCGCGAACGTCGGATCCGGTGGGCCTGCAATCATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATCGACTACCGCATGCGCTGCATCCTGCAGGACGGCCGCATCTTCATCGGCACCTTCAAGGCCTTCGACAAGCACATGAACTTGATCCTCTGCGACTGCGACGAGTTCCGGAAGATCAAGCCAAAGAACGCGAAGCAGCCGGAGCGTGAAGAGAAGCGGGTTTTGGGTCTGGTGCTGCTCCGAGGGGAGAACCTGGTCTCCATGACGGTGGAGGGGCCGCCCCCCAAAGACACCGGCATCGCTCGTGTGCCCCTCGCCGGAGCTGCAGGAGGCCCTGGAGTTGGCAGGGCCGCGGGCCGAGGAGTGCCAGCCGGCGTCCCCATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCCGAGGGGTTGGGGGACCGTCCCAGCAGGTGATGACCCCACAGGGACGAGGCACTGTGGCAGCTGCGGCCGTCGCCGCTACCGCCAGCATTGCCGGAGCCCCAACGCAGTACCCACCAGGTCGGGGGACGCCCCCCACCCCTGTGGGCCGAGCCACCCCACCGCCAGGCATCATGGCTCCTCCCCCTGGCATGAGGCCACCTATGGGCCCACCAATCGGCCTTCCCCCGGCCCGTGGGACACCGATAGGCATGCCCCCCCCAGGCATGAGACCCCCGCCACCAGGAATCAGAGGCCCGCCTCCCCCGGGAATGCGCCCCCCGAGGCCCTAGGACGCTGTCGGTCCTCGGTCACCCCCGCAGTGCGTCTCGTGAAACCGTGTAGAGTGTTCGTGAGCCTTTGTTTCCTCTGCCGCCTCCGTGTTCGCCAATAAACGCATAAGCATGTCCACTGCGA