Transcript asmbl_14812

Sequence
Transcript Sequence for observation asmbl_14812 of TGE0000326:
CTGCCGCTACCCGGAGTATGATGGGCGGGGGGTGCTCATCGCAGTCCTGGACACGGGGGTCGACCCGGGGGCTCCGGGCATGCAGGTTACAACTGATGGAAAACCAAAAATCGTTGATATCATTGATACAACAGGAAGTGGCGATGTGAATACTGCTACAGAAGTAGAGCCAAAGGATGGTGAGATTGTTGGCCTTTCAGGAAGAGTGCTTAAGATTCCTGCAAGCTGGACAAATCCCTCAGGCAAATATCATATTGGCATAAAAAATGGCTATGACTTCTATCCTAAGGCACTCAAGGAAAGGATACAGAAAGAACGGAAGGAAAAAATCTGGGACCCTGTTCACAGAGTGGCCCTTGCAGAAGCCTGTAGAAAACAGGAAGAATTTGATGTTGCCAACAACGGCTCTTCTCAAGCAAATAAACTAATCAAGGAGGAACTTCAAAGTCAAGTGGAATTGCTAAATTCTTTTGAGAAGAAATACAGCGATCCTGGCCCTGTATATGACTGCTTGGTATGGCATGATGGCGAAGTCTGGAGAGCCTGCATTGATTCTAATGAAGATGGGGACTTGAGTAAATCTACCGTGTTGAGAAACTACAAAGAAGCCCAAGAATATGGCTCTTTTGGCACAGCTGAGATGTTGAATTACTCCGTTAATATATACGATGATGGAAACCTGCTCTCCATTGTGACCAGTGGAGGAGCTCATGGGACACATGTAGCTAGTATAGCTGCTGGACACTTTCCAGAAGAACCTGAACGGAATGGGGTAGCTCCTGGTGCTCAAATTCTTTCCATCAAGATTGGTGATACAAGACTAAGCACAATGGAAACAGGCACAGGCCTCATAAGAGCTATGATAGAAGTTATAAATCATAAGTGTGATCTTGTCAACTACAGTTACGGAGAAGCAACTCACTGGCCAAATTCTGGGAGAATTTGTGAAGTAATTAATGAAGCAGTATGGAAGCATAATATAATTTATGTTTCAAGTGCTGGAAATAATGGTCCATGCCTGTCTACAGTTGGTTGTCCAGGTGGAACTACATCAAGTGTGATAGGTGTTGGTGCTTATGTTTCTCCTGATATGATGGTTGCTGAGTATTCACTGAGAGAGAAATTACCTGCAAATCAATATACTTGGTCTTCTAGAGGACCTAGTGCTGACGGGGCCCTTGGTGTGAGTATCAGTGCGCCAGGAGGAGCCATTGCTTCTGTTCCTAACTGGACACTGAGAGGGACGCAGCTGATGAATGGAACATCTATGTCTTCCCCCAATGCATGTGGAGGCATTGCCCTGATCCTTTCAGGTCTGAAAGCTAATAACATTGACTACACAGTTCATTCAGTCAGAAGAGCTCTAGAAAACACTGCAGTGAAGGCTGACAATATAGAAGTATTTGCTCAAGGACATGGTATTATTCAGGTTGATAAAGCCTATGACTACCTCGTTCAGAATACATCATTTGCTAATAAATTAGGTTTTACTGTTACTGTTGGAAATAACCGTGGCATCTACCTCCGAGATCCTGTTCAGGTGGCTGCACCTTCAGATCATGGCGTTGGCATTGAACCTGTATTTCCGGAGAACACAGAAAACTCTGAAAAAATATCCCTTCAGCTTCATTTAGCTCTGACTTCAAATTCATCTTGGGTTCAGTGTCCCAGCCATTTGGAACTCATGAATCAATGTAGACACATAAACATACGTGTGGATCCCAGGGGCTTAAGAGAAGGATTGCATTATACAGAGGTATGTGGCTATGATATAGCATCCCCTAACGCAGGTCCGCTCTTCAGAGTTCCGATCACTGCAGTTATAGCAGCAAAAGTAAATGAATCATCACATTATGATCTAGCCTTTACAGATGTACACTTTAAACCTGGTCAAATTCGAAGGCATTTTATTGAGGTTCCTGAGGGTGCAACATGGGCTGAAGTGACAGTGTGTTCGTGTTCTTCTGAGGTGTCAGCAAAGTTTGTTCTACATGCAGTCCAGCTTGTGAAGCAAAGAGCATATCGAAGCCATGAATTCTATAAGTTTTGTTCTCTTCCAGAGAAAGGAACACTGACTGAAGCTTTTCCTGTCCTAGGTGGAAAAGCAATTGAATTTTGCATTGCTCGTTGGTGGGCAAGTCTCAGTGATGTCAACATTGATTATACCATTTCTTTCCATGGGATAGTGTGTACTGCTCCTCAGTTAAACATTCATGCATCGGAAGGAATCAACCGCTTTGATGTTCAGTCCTCCTTGAAATACGAAGATCTGGCTCCCTGCATAACTTTGAAGAACTGGGTCCAAACACTGCGCCCAGTGAGTGCAAAAACAAAACCTTTAGGATCAAGAGATGTTTTGCCAAATAACCGTCAACTTTATGAGATGGTCCTGACATATAACTTTCATCAACCCAAGAGTGGGGAAGTAACTCCAAGCTGCCCACTACTTTGTGAACTATTATATGAATCTGAATTTGACAGCCAACTGTGGATTATTTTTGACCAGAACAAAAGACAGATGGGTTCAGGCGATGCCTATCCACATCAGTATTCTTTGAAACTGGAGAAAGGAGATTATACAATTCGACTACAGATTCGCCATGAGCAAATCAGTGATTTGGAACGCCTTAAAGACCTTCCATTTATTGTTTCTCATAGATTGTCTAATACCTTGAGCTTAGATATTCATGAAAATCATAGTTTTGCACTTCTAGGGAAGAAGAAATCAAGCAATTTGACATTACCACCCAAATATAACCAGCCATTCTTTGTTACTTCCTTACCTGATGATAAAATACCTAAAGGGGCAGGACCTGGATGCTATCTTGCAGGATCCTTAACATTGTCAAAGACTGAACTAGGAAAGAAAGCTGATGTAATCCCTGTTCATTACTACTTAATACCTCCACCAACAAAGACTAAGAATGGCAGCAAAGATAAGGAAAAAGATTCAGAAAAAGAGAAAGATTTAAAAGAAGAGTTTACTGAAGCATTACGAGATCTTAAAATTCAGTGGATGACAAAGCTGGATTCTAGTGACATTTATAACGAATTGAAAGAAACATATCCTAATTATCTTCCTCTGTACGTTGCACGACTTCATCAATTGGATGCTGAAAAGGAACGAATGAAAAGACTTAATGAAATTGTTGATGCGGCAAATGCTGTTATTTCTCATATAGATCAAACAGCCCTAGCAGTTTATATTGCAATGAAGACTGATCCCAGGCCTGATGCAGCTACTATAAAAAAGTTGCCTTCTGATTTCTGCATCATTCCAGCCCTTCTCTG