Transcript asmbl_11703

Sequence
Transcript Sequence for observation asmbl_11703 of TGE0003531:
GCGGTAAACTGGAAAGATGTCCCTGTATGATGACCTGGGAGTGGAGACCAGCGACTCGAAGACGGAAGGCTGGTCCAAGAACTTCAAGCTGCTGCAGTCTCAGCTTCAGGTGAAGAAGGCGGCCCTCACCCAGGCGAAGAGCCAGAGGACAAAACAAAGCACAGTCCTCGCCCCGGTAATCGACCTAAAGCGAGGCGGCTCTTCAGACGACCGGCAGGTCGTGGACACCCCGCCGCACGTAGCCGCCGGCCTCAAGGATCCTGTACCCAGTGGATTTTCCGCGGGAGAAGTTCTGATTCCCTTAGCCGACGAATACGACCCTATGTTCCCTAACGATTATGAGAAAGTCGTGAAACGCCAGAGAGAGGAGCGACAGAGACAGCGAGAGCTGGAAAGACAGAAAGAAATAGAAGAGAGAGAAAAGAGGCGTAAAGACCGACACGAGGCCAGTGGGTTTTCAAGGCGACCAGACCCAGATTCTGATGAAGATGAAGATTACGAGCGAGAGAGGAGGAAAAGAAGTATGGGCGGAGCCGCCATCGCCCCACCCACCTCTCTCGTGGAGAAAGACAAAGAGTTACCCCGAGAATTTCCTTACGAAGAGGACTCCCGACCGCGCTCACAGTCTTCCAAAGCCGCCGTTCCTCCGCCGGTGTACGAGGAGCAGGACAGGCCCCGGTCCCCAACGGGGCCTGGCAACTCCTTCCTCGCCAACATGGGGGGCACGGTCGCTCATAAAATCATGCAGAAGTACGGCTTCCGGGAAGGCCAGGGGCTCGGGAAGCACGAGCAAGGGCTGAGCACGGCGTTGTCGGTGGAGAAGACGAGCAAGCGAGGAGGCAAGATCATTGTGGGCGAAGTCACAGAGAAAGATGCATCCAAGAAGTCGGATTCAAATCCACTAACTGAAATACTTAAGTGTCCTACTAAAGTGGTCCTACTAAGGAACATGGTTGGTGCAGGAGAGGTAGATGAAGACTTGGAGGTTGAAACCAAGGAAGAGTGTGAAAAATATGGCAAAGTTGGAAAATGTGTGATATTCGAAATCCCTGGTGCCCCTGACGATGAAGCAGTGCGGATATTTTTAGAATTCGAGAGGGTCGAATCAGCAATTAAAGCTGTCGTAGATCTGAATGGGAGGTATTTCGGTGGCCGGGTGGTAAAAGCATGTTTCTACAATTTGGATAAGTTCAGAGTCTTGGATTTGGCGGAACAAGTTTGATTTTAAGAACTGGAGCACGAACCACAAGCTCCAAGCCGAGCAGAGGAGGCGACAGCCAGCTCGCGTGCTGTGTGCGCAGGGACTCAGAAGGGCTGCTGAGATGTGTGTTGATTGGTCCCTTTTTTTTTATTTTGTGTTTTTTTAATATAGCATAAAAATCCTTAAAA