Transcript asmbl_11384

Sequence
Transcript Sequence for observation asmbl_11384 of TGE0003523:
CGCGTGGCTCCGAGTGCGCCTGCGCGGAGCGCCGGGACAGGGCGTGTTCCTCGTTCGGGTGCGCGTCTACCTCAGGCGGGCTGCGGTTTTCCCTCCCCGCAGTCGTGCGCCCTGCGGGACCCCGTCATTTCTACGCCCAGCCTGATACGTGCCGCTCTCCGCGATCATGTCCAAGTCTCTGAAAAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCGGAAGTGGACATGAGTGACCGCGGCATCTCCAACATGCTGGATGTCAACGGCCTGTTCTCCTTATCCCACATCACGCAGCTGGTCCTCAGCCACAACAAGCTAACAACCGTGCCACCTAACATAGCGGAACTGAAGAATCTGGAAGTGCTCAACTTTTTTAACAACCAGATTGAGGAGCTGCCCACACAGATCAGCAGCCTTCAGAAACTCAAGCACCTGAACTTGGGCATGAACAGACTAAACACTTTGCCTCGAGGATTTGGCTCCCTCCCAGCCCTTGAGGTCCTTGATTTGACTTACAACAACTTGAATGAAAATTCTCTTCCTGGAAATTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACTCAGCTTAAGGAGCTCCACATTCAGGGGAACCGCCTGACCGTTCTGCCCCCAGAACTAGGAAACTTGGATCTGACTGGTCAGAAGCAGGTATTCAAAGCAGAGAACAACCCCTGGGTCACCCCGATCGCTGACCAGTTCCAGCTTGGTGTGTCCCATGTATTTGAGTATATCCGTTCCGAGACGTACAAGTATCTCTACGGCAGACACATGCAGGCAAATCCAGAACCGCCGAAGAAAAATAATGACAAAACGAAAAAGATCAGCCGGAAGCCTCTGACAGCCAAGAACAAATGAGGGGTTGGCATGGGCTGGACTTCCGGTCACTTCGCTCGTTATTACTTCTGTTCTCTTGCTCTGTCCCACGATCAGTTATGGTTGACCCTTGAGCAACTTGGGTTTGAACTGAGCGGGTCCATTATATGCAGATTTTCTTCAATAAATTCTGCAAATGTATTTTCCTAATGATTCTCTTAAGATTTTCTTTTCTCTAACTTTGGTATAAGAATACAGTATATAATATGTATAACATACAAAATAGGTGTTAATAGACTGTTTACGTTAATAGACAGGAGGCTATCAGTAGTAAAGTTTTGGGGTGTCAGGTTATATGTGGATTTTCAACTGTGTAAGGGGGCGGCACCCCAACCCTCACATTGTTCAAGGGTCAACTGTACAGTGTGTATCTCTGAGTGTGTGTGAGTGCATGTGTTTCTTTTCATATTTTTCTTCCTACTGCTTACCAATTTTTATCTTTTAATTTCTTTTGGTAGGTAGTAGATTTTTATAAGTTTTAAAAACCCTTTCTTACCTTAAAAATTACCAAAGGCAGGAAACAAAGCTCTGATTCAACTGCTAATTCCGTAGTAGGCACTGATTTCAGCTCCTTGAATAGATGCTCGTAAAGTCGCTGCTTATCAAAAGCATAATTAAAATCACGTAATCGTTTAAATGTCACAGCACTGTTCACGCTTCTGTTTATTCATGTAATTCATTCTTTCGCCTTATTAAAAATTTTCCTTCGCCACTGAGATATTATGTTAACTTTCTTCACATACGATTTTAATAAAATCTTGAATTTGCACAACGTGTTGCCTCCTGAATACAGAACAATCTGACTTTGGGGTGTATACACATTTTTGTTTACTCTTTTTCCCAAAATTAATCTTGTCCACTTTTATTGGTTGTAGATGATAAACCCTGAAACTTCTCATGAAAAAAAT